Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

P2RX4 cdna clone

P2RX4 cDNA Clone

Gene Names
P2RX4; P2X4; P2X4R
Synonyms
P2RX4; P2RX4 cDNA Clone; P2RX4 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgggctgctgcgccgcgctggcggccttcctgttcgagtacgacacgccgcgcatcgtgctcatccgcagccgcaaagtggggctcatgaaccgcgccgtgcaactgctcatcctggcctacgtcatcgggtgggtgtttgtgtgggaaaagggctaccaggaaactgactccgtggtcagctccgttacgaccaaggtcaagggcgtggctgtgaccaacacttctaaacttggattccggatctgggatgtggcggattatgtgataccagctcaggaggaaaactccctcttcgtcatgaccaacgtgatcctcaccatgaaccagacacagggcctgtgccccgagattccagatgcgaccactgtgtgtaaatcagatgccagctgtactgccggctctgccggcacccacagcaacggagtctcaacaggcaggtgcgtagctttcaacgggtccgtcaagacgtgtgaggtggcggcctggtgcccggtggaggatgacacacacgtgccacaacctgcttttttaaaggctgcagaaaacttcactcttttggttaagaacaacatctggtatcccaaatttaatttcagcaagaggaatatccttcccaacatcaccactacttacctcaagtcgtgcatttatgatgctaaaacagatcccttctgccccatattccgtcttggcaaaatagtggagaacgcaggacacggtttccaggacatggccgtggagggaggcatcatgggcatccaggtcaactgggactgcaacctggacagagccgcctccctctgcttgcccaggtactccttccgccgcctcgatacacgggacgttgagcacaacgtatctcctggctacaatttcaggtttgccaagtactacagagacctggctggcaacgagcagcgcacgctcatcaaggcctatggcatccgcttcgacatcattgtgtttgggaaggcagggaaatttgacatcatccccactatgatcaacatcggctctggcctggcactgctaggcatggcgaccgtgctgtgtgacatcatagtcctctactgcatgaagaaaagactctactatcgggagaagaaatataaatatgtggaagattacgagcagggtcttgctagtgagctggaccagtga
Sequence Length
1167
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,481 Da
NCBI Official Full Name
Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 4, mRNA
NCBI Official Synonym Full Names
purinergic receptor P2X 4
NCBI Official Symbol
P2RX4
NCBI Official Synonym Symbols
P2X4; P2X4R
NCBI Protein Information
P2X purinoceptor 4
UniProt Protein Name
P2X purinoceptor 4
Protein Family
UniProt Gene Name
P2RX4
UniProt Synonym Gene Names
P2X4
UniProt Entry Name
P2RX4_HUMAN

NCBI Description

The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel with high calcium permeability. The main pharmacological distinction between the members of the purinoceptor family is the relative sensitivity to the antagonists suramin and PPADS. The product of this gene has the lowest sensitivity for these antagonists. Multiple alternatively spliced transcript variants, some protein-coding and some not protein-coding, have been found for this gene. [provided by RefSeq, Feb 2012]

Uniprot Description

P2X4: Receptor for ATP that acts as a ligand-gated ion channel. This receptor is insensitive to the antagonists PPADS and suramin. Belongs to the P2X receptor family.

Protein type: Membrane protein, integral; Membrane protein, multi-pass; Channel, ligand-gated

Chromosomal Location of Human Ortholog: 12q24.32

Cellular Component: cell junction; integral to nuclear inner membrane; integral to plasma membrane; lysosomal membrane; membrane; perinuclear region of cytoplasm; plasma membrane

Molecular Function: ATP binding; ATP-gated cation channel activity; cadherin binding; copper ion binding; protein binding; purinergic nucleotide receptor activity; receptor binding; zinc ion binding

Biological Process: blood coagulation; endothelial cell activation; membrane depolarization; positive regulation of calcium-mediated signaling; regulation of blood pressure; regulation of sodium ion transport; response to ATP; sensory perception of pain; signal transduction; transport

Research Articles on P2RX4

Similar Products

Product Notes

The P2RX4 p2rx4 (Catalog #AAA1270795) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgggct gctgcgccgc gctggcggcc ttcctgttcg agtacgacac gccgcgcatc gtgctcatcc gcagccgcaa agtggggctc atgaaccgcg ccgtgcaact gctcatcctg gcctacgtca tcgggtgggt gtttgtgtgg gaaaagggct accaggaaac tgactccgtg gtcagctccg ttacgaccaa ggtcaagggc gtggctgtga ccaacacttc taaacttgga ttccggatct gggatgtggc ggattatgtg ataccagctc aggaggaaaa ctccctcttc gtcatgacca acgtgatcct caccatgaac cagacacagg gcctgtgccc cgagattcca gatgcgacca ctgtgtgtaa atcagatgcc agctgtactg ccggctctgc cggcacccac agcaacggag tctcaacagg caggtgcgta gctttcaacg ggtccgtcaa gacgtgtgag gtggcggcct ggtgcccggt ggaggatgac acacacgtgc cacaacctgc ttttttaaag gctgcagaaa acttcactct tttggttaag aacaacatct ggtatcccaa atttaatttc agcaagagga atatccttcc caacatcacc actacttacc tcaagtcgtg catttatgat gctaaaacag atcccttctg ccccatattc cgtcttggca aaatagtgga gaacgcagga cacggtttcc aggacatggc cgtggaggga ggcatcatgg gcatccaggt caactgggac tgcaacctgg acagagccgc ctccctctgc ttgcccaggt actccttccg ccgcctcgat acacgggacg ttgagcacaa cgtatctcct ggctacaatt tcaggtttgc caagtactac agagacctgg ctggcaacga gcagcgcacg ctcatcaagg cctatggcat ccgcttcgac atcattgtgt ttgggaaggc agggaaattt gacatcatcc ccactatgat caacatcggc tctggcctgg cactgctagg catggcgacc gtgctgtgtg acatcatagt cctctactgc atgaagaaaa gactctacta tcgggagaag aaatataaat atgtggaaga ttacgagcag ggtcttgcta gtgagctgga ccagtga. It is sometimes possible for the material contained within the vial of "P2RX4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.