Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

OXSR1 cdna clone

OXSR1 cDNA Clone

Gene Names
OXSR1; OSR1
Synonyms
OXSR1; OXSR1 cDNA Clone; OXSR1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccgaggactcgagcgccctgccctggtccatcaacagggacgattacgagctgcaggaggtgatcgggagtggagcaactgctgtagtccaagcagcttattgtgcccctaaaaaggagaaagtggcaatcaaacggataaaccttgagaaatgtcaaactagcatggatgaactcctgaaagaaattcaagccatgagtcaatgccatcatcctaatattgtatcttactacacatcttttgtggtaaaagatgagctgtggcttgtcatgaagctgctaagtggaggttctgttctggatattattaagcacattgtggcaaaaggggaacacaaaagtggagtcctagatgaatctaccattgctacgatactccgagaagtactggaagggctggaatatctgcataaaaatggacagatccacagagatgtgaaagctggaaacattcttcttggagaagatggctcagtacagattgcagactttggggttagtgcttttttagcaactggtggtgatattacccgaaataaagtgagaaagacctttgttggcaccccttgttggatggcacctgaagttatggaacaggtccgtggttatgatttcaaagctgatatttggagttttggaattacagcaattgaattggctacaggggcggctccttatcataaatatccaccaatgaaggttttaatgctgacactgcagaacgatcctccttctttggaaactggtgttcaagataaagaaatgctgaaaaaatatggaaaatcatttagaaaaatgatttcattgtgccttcaaaaagatccagaaaaaagaccaacagcagcagaactattaaggcacaaatttttccagaaagcaaagaataaagaatttcttcaagaaaaaacattgcagagagcaccaaccatttctgaaagagcaaaaaaggttcggagagtaccaggttccagtgggcgtcttcataagacagaggatggaggctgggagtggagtgatgatgaatttgatgaagaaagtgaggaagggaaagcagcaatttcacaactcaggtctccccgagtgaaagaatcaatatcaaattctgagctctttccaacaactgatcctgtgggtactttgctccaagttccagaacagatctctgctcatctacctcagccagctgggcagattgctacacagccaactcaagtctctctcccacccaccgcagagccagcaaaaacagctcaggctttgtcttcaggatcaggttcacaagaaaccaagatcccaatcagtctagtactaagattaaggaattccaaaaaagaactaaatgatattcgatttgaatttactcctgggagagatacagcagagggtgtctctcaggaactcatttctgctggcctggtcgacggaagggatttagtaatagtggcagctaatttgcagaaaattgtggaagaacctcagtcaaatcgatctgtcactttcaaactggcatctggtgtcgaaggctcagatattcctgatgatggtaaactgataggatttgcccagctcagcatcagctaa
Sequence Length
1584
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,022 Da
NCBI Official Full Name
Homo sapiens oxidative-stress responsive 1, mRNA
NCBI Official Synonym Full Names
oxidative stress responsive 1
NCBI Official Symbol
OXSR1
NCBI Official Synonym Symbols
OSR1
NCBI Protein Information
serine/threonine-protein kinase OSR1
UniProt Protein Name
Serine/threonine-protein kinase OSR1
UniProt Gene Name
OXSR1
UniProt Entry Name
OXSR1_HUMAN

NCBI Description

The product of this gene belongs to the Ser/Thr protein kinase family of proteins. It regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton. [provided by RefSeq, Jul 2008]

Uniprot Description

OSR1: oxidative-stress responsive 1 protein is a ubiquitously expressed protein kinase of the STE20 family. Regulates Na-K-Cl cotransporter (NKCC) activity. Regulates downstream kinases in response to environmental stress. May also have a function in regulating the actin cytoskeleton. Binds to and phosphorylates PAK1. Interacts and is phosphorylated by WNK1. Knockdown of either WNK1 or OXSR1 reduces NKCC activity. Interacts with chloride channel proteins SLC12A6 isoform 2, SLC12A1 and SLC12A2 but not with SLC12A4 and SLC12A7, possibly establishing sensor/signaling modules that initiate the cellular response to environmental stress. An important paralog of this gene is STRADB.

Protein type: Protein kinase, STE; EC 2.7.11.1; Protein kinase, Ser/Thr (non-receptor); Kinase, protein; STE group; STE20 family; FRAY subfamily

Chromosomal Location of Human Ortholog: 3p22.2

Cellular Component: cytoplasm

Molecular Function: ATP binding; magnesium ion binding; protein binding; protein serine/threonine kinase activity; receptor signaling protein serine/threonine kinase activity

Biological Process: peptidyl-threonine phosphorylation; protein amino acid phosphorylation

Research Articles on OXSR1

Similar Products

Product Notes

The OXSR1 oxsr1 (Catalog #AAA1269139) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccgagg actcgagcgc cctgccctgg tccatcaaca gggacgatta cgagctgcag gaggtgatcg ggagtggagc aactgctgta gtccaagcag cttattgtgc ccctaaaaag gagaaagtgg caatcaaacg gataaacctt gagaaatgtc aaactagcat ggatgaactc ctgaaagaaa ttcaagccat gagtcaatgc catcatccta atattgtatc ttactacaca tcttttgtgg taaaagatga gctgtggctt gtcatgaagc tgctaagtgg aggttctgtt ctggatatta ttaagcacat tgtggcaaaa ggggaacaca aaagtggagt cctagatgaa tctaccattg ctacgatact ccgagaagta ctggaagggc tggaatatct gcataaaaat ggacagatcc acagagatgt gaaagctgga aacattcttc ttggagaaga tggctcagta cagattgcag actttggggt tagtgctttt ttagcaactg gtggtgatat tacccgaaat aaagtgagaa agacctttgt tggcacccct tgttggatgg cacctgaagt tatggaacag gtccgtggtt atgatttcaa agctgatatt tggagttttg gaattacagc aattgaattg gctacagggg cggctcctta tcataaatat ccaccaatga aggttttaat gctgacactg cagaacgatc ctccttcttt ggaaactggt gttcaagata aagaaatgct gaaaaaatat ggaaaatcat ttagaaaaat gatttcattg tgccttcaaa aagatccaga aaaaagacca acagcagcag aactattaag gcacaaattt ttccagaaag caaagaataa agaatttctt caagaaaaaa cattgcagag agcaccaacc atttctgaaa gagcaaaaaa ggttcggaga gtaccaggtt ccagtgggcg tcttcataag acagaggatg gaggctggga gtggagtgat gatgaatttg atgaagaaag tgaggaaggg aaagcagcaa tttcacaact caggtctccc cgagtgaaag aatcaatatc aaattctgag ctctttccaa caactgatcc tgtgggtact ttgctccaag ttccagaaca gatctctgct catctacctc agccagctgg gcagattgct acacagccaa ctcaagtctc tctcccaccc accgcagagc cagcaaaaac agctcaggct ttgtcttcag gatcaggttc acaagaaacc aagatcccaa tcagtctagt actaagatta aggaattcca aaaaagaact aaatgatatt cgatttgaat ttactcctgg gagagataca gcagagggtg tctctcagga actcatttct gctggcctgg tcgacggaag ggatttagta atagtggcag ctaatttgca gaaaattgtg gaagaacctc agtcaaatcg atctgtcact ttcaaactgg catctggtgt cgaaggctca gatattcctg atgatggtaa actgatagga tttgcccagc tcagcatcag ctaa. It is sometimes possible for the material contained within the vial of "OXSR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.