Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

OSR2 cdna clone

OSR2 cDNA Clone

Synonyms
OSR2; OSR2 cDNA Clone; OSR2 cdna clone
Ordering
For Research Use Only!
Sequence
atggggagcaaggctctgccagcgcccatcccgctccacccgtcgctgcagctcaccaattactccttcctgcaggccgtgaacaccttcccggccacggtggaccacctgcagggcctgtacggtctcagcgcggtacagaccatgcacatgaaccactggacgctggggtatcccaatgtgcacgagatcacccgctccaccatcacggagatggcggcggcgcagggcctcgtggacgcgcgcttccccttcccggccctgccttttaccacccacctattccaccccaagcagggggccattgcccacgtcctcccagccctgcacaaggaccggccccgttttgactttgccaatttggcggtggctgccacgcaagaggatccgcctaagatgggagacctgagcaagctgagcccaggactgggtagccccatctcgggcctcagtaaattgactccggacagaaagccctctcgaggaaggttgccctccaaaacgaaaaaagagtttatctgcaagttttgcggcagacactttaccaaatcctacaatttgctcatccatgagaggacccacacggacgagaggccgtacacgtgtgacatctgccacaaggccttccggaggcaagatcacctgcgggatcacagatacatccattccaaagaaaaacccttcaaatgtcaggagtgtgggaaaggattttgtcagtctagaactctagcagttcacaaaactttacacatgcagacatcaagccctacagctgcgagcagtgcggcaaagtgttcaggcgaaactgtgatctgcggcggcacagcctga
Sequence Length
831
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,771 Da
NCBI Official Full Name
Homo sapiens odd-skipped related 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
odd-skipped related transciption factor 2
NCBI Official Symbol
OSR2
NCBI Protein Information
protein odd-skipped-related 2
UniProt Protein Name
Protein odd-skipped-related 2
UniProt Gene Name
OSR2
UniProt Entry Name
OSR2_HUMAN

NCBI Description

OSR2 is a mammalian homolog of the Drosophila odd-skipped family of transcription factors (Lan et al., 2004 [PubMed 15175245]).[supplied by OMIM, Mar 2008]

Uniprot Description

OSR2: Belongs to the Odd C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 8q22.2

Cellular Component: nucleus

Molecular Function: protein binding; sequence-specific DNA binding

Biological Process: cell differentiation; chondrocyte differentiation; embryonic development; embryonic digit morphogenesis; embryonic forelimb morphogenesis; embryonic hindlimb morphogenesis; embryonic skeletal morphogenesis; mesonephros development; metanephros development; middle ear morphogenesis; negative regulation of transcription from RNA polymerase II promoter; odontogenesis; osteoblast proliferation; palate development; positive regulation of bone mineralization; positive regulation of cell proliferation; positive regulation of epithelial cell proliferation; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent

Research Articles on OSR2

Similar Products

Product Notes

The OSR2 osr2 (Catalog #AAA1267138) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggagca aggctctgcc agcgcccatc ccgctccacc cgtcgctgca gctcaccaat tactccttcc tgcaggccgt gaacaccttc ccggccacgg tggaccacct gcagggcctg tacggtctca gcgcggtaca gaccatgcac atgaaccact ggacgctggg gtatcccaat gtgcacgaga tcacccgctc caccatcacg gagatggcgg cggcgcaggg cctcgtggac gcgcgcttcc ccttcccggc cctgcctttt accacccacc tattccaccc caagcagggg gccattgccc acgtcctccc agccctgcac aaggaccggc cccgttttga ctttgccaat ttggcggtgg ctgccacgca agaggatccg cctaagatgg gagacctgag caagctgagc ccaggactgg gtagccccat ctcgggcctc agtaaattga ctccggacag aaagccctct cgaggaaggt tgccctccaa aacgaaaaaa gagtttatct gcaagttttg cggcagacac tttaccaaat cctacaattt gctcatccat gagaggaccc acacggacga gaggccgtac acgtgtgaca tctgccacaa ggccttccgg aggcaagatc acctgcggga tcacagatac atccattcca aagaaaaacc cttcaaatgt caggagtgtg ggaaaggatt ttgtcagtct agaactctag cagttcacaa aactttacac atgcagacat caagccctac agctgcgagc agtgcggcaa agtgttcagg cgaaactgtg atctgcggcg gcacagcctg a. It is sometimes possible for the material contained within the vial of "OSR2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.