OSGIN2 cdna clone
OSGIN2 cDNA Clone
Gene Names
OSGIN2; hT41; C8orf1
Synonyms
OSGIN2; OSGIN2 cDNA Clone; OSGIN2 cdna clone
Sequence
atgccattagttgaagaaacttctttactggaagattcgtcagtgacttttcctgtggtaataataggaaatggaccctcaggaatatgcctttcttatatgttatcaggctacagaccgtatttatcatcagaagcaatacacccaaatacaatcttaaatagtaaattagaagaagcaagacatctttccattgttgatcaggacttagaatacttgtctgagggccttgagggccgatcatccaatccagttgcagtacttttcgatacacttcttcatccagatgctgactttgggtatgattatccatccgttttgcattggaaattagagcaacatcattatatccctcacgtagttcttggtaaaggtccacctggtggggcttggcataatatggaaggctccatgttgacaatcagctttggaagttggatggaactacctggacttaaatttaaggactgggtatcaagtaaacgaaggagcctaaaaggggatcgagttatgccagaggaaatagctcgctactataaacattatgtaaaagtcatgggtcttcagaagaatttcagagagaatacttacataacttccgtatcaagactctacagagatcaagatgatgatgatattcaagacagagatatttcaacaaagcatttacagatagagaagtcaaactttatcaagagaaactgggaaattaggggttatcagcgaatagctgatggttctcatgttcccttctgcctctttgctgagaatgtagcgctggcaactggaacgctggattctcctgcccatctggaaattgaaggggaagattttccttttgtgtttcattcaatgcctgaatttggagctgctataaacaaaggaaagttgcgtggcaaagtggatccagtgttaattgtaggttctgggcttactgccgctgacgcagtactgtgtgcttacaacagtaatatccctgtgattcatgtgtttcgcagacgagtaactgatccaagcttaattttcaaacagcttcccaaaaagctgtatcctgaatatcataaagtctatcatatgatgtgtactcagtcatattctgtagactcaaatcttttatctgattataccagctttcccgagcaccgtgtgctttcctttaagtcggacatgaaatgtgttctccaaagcgtttctggattgaagaaaatatttaagctgtctgcagcagtagtattgataggttctcatcctaatctgtcttttctgaaggatcaagggtgttacctaggccataagtcaagccagccaatcacatgtaagggtaatcctgtggaaatagatacatatacctatgagtgtattaaagaagccaacctttttgcattgggtcctttggttggagacaattttgttcgatttttaaagggaggggcgctgggtgttacacgctgtttagctacaagacagaagaaaaagcatttgtttgttgaaagaggaggaggagatgggatagcttaa
Sequence Length
1518
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
61,698 Da
NCBI Official Full Name
Homo sapiens oxidative stress induced growth inhibitor family member 2, mRNA
NCBI Official Synonym Full Names
oxidative stress induced growth inhibitor family member 2
NCBI Official Symbol
OSGIN2
NCBI Official Synonym Symbols
hT41; C8orf1
NCBI Protein Information
oxidative stress-induced growth inhibitor 2
UniProt Protein Name
Oxidative stress-induced growth inhibitor 2
Protein Family
UniProt Gene Name
OSGIN2
UniProt Synonym Gene Names
C8orf1
UniProt Entry Name
OSGI2_HUMAN
Uniprot Description
OSGIN2: May be involved in meiosis or the maturation of germ cells. Belongs to the OKL38 family. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 8q21
Similar Products
Product Notes
The OSGIN2 osgin2 (Catalog #AAA1270614) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccattag ttgaagaaac ttctttactg gaagattcgt cagtgacttt tcctgtggta ataataggaa atggaccctc aggaatatgc ctttcttata tgttatcagg ctacagaccg tatttatcat cagaagcaat acacccaaat acaatcttaa atagtaaatt agaagaagca agacatcttt ccattgttga tcaggactta gaatacttgt ctgagggcct tgagggccga tcatccaatc cagttgcagt acttttcgat acacttcttc atccagatgc tgactttggg tatgattatc catccgtttt gcattggaaa ttagagcaac atcattatat ccctcacgta gttcttggta aaggtccacc tggtggggct tggcataata tggaaggctc catgttgaca atcagctttg gaagttggat ggaactacct ggacttaaat ttaaggactg ggtatcaagt aaacgaagga gcctaaaagg ggatcgagtt atgccagagg aaatagctcg ctactataaa cattatgtaa aagtcatggg tcttcagaag aatttcagag agaatactta cataacttcc gtatcaagac tctacagaga tcaagatgat gatgatattc aagacagaga tatttcaaca aagcatttac agatagagaa gtcaaacttt atcaagagaa actgggaaat taggggttat cagcgaatag ctgatggttc tcatgttccc ttctgcctct ttgctgagaa tgtagcgctg gcaactggaa cgctggattc tcctgcccat ctggaaattg aaggggaaga ttttcctttt gtgtttcatt caatgcctga atttggagct gctataaaca aaggaaagtt gcgtggcaaa gtggatccag tgttaattgt aggttctggg cttactgccg ctgacgcagt actgtgtgct tacaacagta atatccctgt gattcatgtg tttcgcagac gagtaactga tccaagctta attttcaaac agcttcccaa aaagctgtat cctgaatatc ataaagtcta tcatatgatg tgtactcagt catattctgt agactcaaat cttttatctg attataccag ctttcccgag caccgtgtgc tttcctttaa gtcggacatg aaatgtgttc tccaaagcgt ttctggattg aagaaaatat ttaagctgtc tgcagcagta gtattgatag gttctcatcc taatctgtct tttctgaagg atcaagggtg ttacctaggc cataagtcaa gccagccaat cacatgtaag ggtaatcctg tggaaataga tacatatacc tatgagtgta ttaaagaagc caaccttttt gcattgggtc ctttggttgg agacaatttt gttcgatttt taaagggagg ggcgctgggt gttacacgct gtttagctac aagacagaag aaaaagcatt tgtttgttga aagaggagga ggagatggga tagcttaa. It is sometimes possible for the material contained within the vial of "OSGIN2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
