OSGEPL1 cdna clone

OSGEPL1 cDNA Clone

Gene Names

OSGEPL1; Qri7; OSGEPL

Synonyms

OSGEPL1; OSGEPL1 cDNA Clone; OSGEPL1 cdna clone

Ordering
Cat. Num. AAA1273505 For Research Use Only!

Sequence

atgctaatcttgactaagactgcaggagttttttttaaaccatcaaaaaggaaagtttatgaatttttaagaagttttaattttcatcctggaacactatttcttcataaaatagtattgggaattgaaactagttgtgatgatacagcagctgctgtggtggatgaaactggaaatgtgttgggagaagcaatacattcccaaactgaagttcatttaaaaacaggtgggattgttcctccagcagctcaacagcttcacagagaaaatattcaacgaatagtacaagaagctctttctgccagtggagtctctccaagtgacctctcagcaattgcaactaccataaaaccaggacttgctttaagcctgggagtgggcttatcatttagcttacagctggtaggacagttaaaaaagccattcattcccattcatcatatggaggctcatgcacttactattaggttgaccaataaagtagaatttccttttttagttcttttgatttctggaggtcactgtctgttggcattagttcaaggagtttcagattttctgcttcttggaaagtctttggacatagcaccaggtgacatgcttgacaaggtggcaagaagactttctttaataaaacatccagagtgctccaccatgagtggtgggaaagccatagaacatttggccaaacaaggaaatagatttcattttgacatcaaacctcccttgcatcatgctaaaaattgtgatttttcttttactggacttcaacacgttactgataaaataataatgaaaaaggaaaaagaggaaggtattgagaaggggcaaatcctgtcttcagcagcagacattgctgccacagtacagcacacaatggcatgtcatcttgtgaaaagaacacatcgggctattctgttttgtaagcagagagacttgttacctcaaaataatgcagtactggttgcatctggtggtgtcgcaagtaacttctatatccgcagagctctggaaattttaacaaacgcaacacagtgcactttgttgtgtcctcctcccagactatgcactgataatggcattatgattgcatggaatggtattgaaagactacgtgctggcttgggcattttacatgacatagaaggcatccgctatgaaccaaaatgtcctcttggagtagacatatcaaaagaagttggagaagcttccataaaagtaccacaattaaaaatggagatatga

Sequence Length

1245

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

40225818

NCBI GeneID

64172

Molecular Weight

32,586 Da

NCBI Official Full Name

Homo sapiens O-sialoglycoprotein endopeptidase-like 1, mRNA

NCBI Official Synonym Full Names

O-sialoglycoprotein endopeptidase like 1

NCBI Official Symbol

OSGEPL1

NCBI Official Synonym Symbols

Qri7; OSGEPL

NCBI Protein Information

probable tRNA N6-adenosine threonylcarbamoyltransferase, mitochondrial

UniProt Protein Name

Probable tRNA N6-adenosine threonylcarbamoyltransferase, mitochondrial

UniProt Gene Name

OSGEPL1

UniProt Synonym Gene Names

t(6)A synthase

UniProt Entry Name

OSGP2_HUMAN

Uniprot Description

OSGEPL1: Required for the formation of a threonylcarbamoyl group on adenosine at position 37 (t(6)A37) in tRNAs that read codons beginning with adenine. Belongs to the KAE1 / YgjD family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 2.6.99.4; Protease

Chromosomal Location of Human Ortholog: 2q32.2

Cellular Component: mitochondrion

Research Articles on OSGEPL1

1. Observational study of gene-disease association. (HuGE Navigator)

Similar Products

Product Notes

The OSGEPL1 osgepl1 (Catalog #AAA1273505) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctaatct tgactaagac tgcaggagtt ttttttaaac catcaaaaag gaaagtttat gaatttttaa gaagttttaa ttttcatcct ggaacactat ttcttcataa aatagtattg ggaattgaaa ctagttgtga tgatacagca gctgctgtgg tggatgaaac tggaaatgtg ttgggagaag caatacattc ccaaactgaa gttcatttaa aaacaggtgg gattgttcct ccagcagctc aacagcttca cagagaaaat attcaacgaa tagtacaaga agctctttct gccagtggag tctctccaag tgacctctca gcaattgcaa ctaccataaa accaggactt gctttaagcc tgggagtggg cttatcattt agcttacagc tggtaggaca gttaaaaaag ccattcattc ccattcatca tatggaggct catgcactta ctattaggtt gaccaataaa gtagaatttc cttttttagt tcttttgatt tctggaggtc actgtctgtt ggcattagtt caaggagttt cagattttct gcttcttgga aagtctttgg acatagcacc aggtgacatg cttgacaagg tggcaagaag actttcttta ataaaacatc cagagtgctc caccatgagt ggtgggaaag ccatagaaca tttggccaaa caaggaaata gatttcattt tgacatcaaa cctcccttgc atcatgctaa aaattgtgat ttttctttta ctggacttca acacgttact gataaaataa taatgaaaaa ggaaaaagag gaaggtattg agaaggggca aatcctgtct tcagcagcag acattgctgc cacagtacag cacacaatgg catgtcatct tgtgaaaaga acacatcggg ctattctgtt ttgtaagcag agagacttgt tacctcaaaa taatgcagta ctggttgcat ctggtggtgt cgcaagtaac ttctatatcc gcagagctct ggaaatttta acaaacgcaa cacagtgcac tttgttgtgt cctcctccca gactatgcac tgataatggc attatgattg catggaatgg tattgaaaga ctacgtgctg gcttgggcat tttacatgac atagaaggca tccgctatga accaaaatgt cctcttggag tagacatatc aaaagaagtt ggagaagctt ccataaaagt accacaatta aaaatggaga tatga. It is sometimes possible for the material contained within the vial of "OSGEPL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

OSGEPL1 cdna clone