OSGEP cdna clone
OSGEP cDNA Clone
Gene Names
OSGEP; KAE1; GCPL1; OSGEP1; PRSMG1
Synonyms
OSGEP; OSGEP cDNA Clone; OSGEP cdna clone
Sequence
atgccggcggtgctgggttttgaaggcagcgccaataagattggcgtgggcgtggtgcgggatggcaaggtgctggcgaacccgcggcggacttacgtcacgcctcctggcacaggattccttccaggtgatacagccaggcatcaccgagctgttatcctagacctgctgcaggaggcactaacagagtctggattaacctcccaggatatcgactgcattgcatacaccaagggccctggcatgggtgccccactggtttctgtggctgttgtggcccgtactgtggcccaactgtggaataagccattggtgggtgtgaaccactgtataggccacattgagatgggccgcctcatcactggagccaccagcccaaccgtgttgtatgtgagtggaggaaatacgcaggtgattgcatactcggaacatcgttaccgtatctttggggaaaccatcgatattgcagtgggtaattgtctggatcgttttgctcgagtgctgaagatttctaacgacccaagtccaggatacaacattgaacagatggcaaagcgaggcaagaagctagttgagctgccatacactgtaaaggggatggacgtctcattctcagggatcctgtctttcattgaggatgtagcccatcggatgctggccacaggcgagtgtactcctgaggatctgtgtttctccctgcaggaaactgtgtttgcaatgctggtagagatcacagagcgagccatggcacattgtggctcccaggaggccctcattgtgggaggagtggggtgtaatgtgaggctacaggagatgatggcaacaatgtgccaggaacgtggagcccggctttttgctacagatgagagattctgtattgacaatggagcgatgatagcccaggctggctgggagatgtttcgggctggacacaggaccccactcagtgattctggggttacacagaggtatcggacagatgaagtagaggtgacctggagggactaa
Sequence Length
1008
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
36,427 Da
NCBI Official Full Name
Homo sapiens O-sialoglycoprotein endopeptidase, mRNA
NCBI Official Synonym Full Names
O-sialoglycoprotein endopeptidase
NCBI Official Symbol
OSGEP
NCBI Official Synonym Symbols
KAE1; GCPL1; OSGEP1; PRSMG1
NCBI Protein Information
probable tRNA N6-adenosine threonylcarbamoyltransferase
UniProt Protein Name
Probable tRNA N6-adenosine threonylcarbamoyltransferase
Protein Family
UniProt Gene Name
OSGEP
UniProt Synonym Gene Names
t(6)A synthase; hOSGEP
UniProt Entry Name
OSGEP_HUMAN
Uniprot Description
OSGEP: Required for the formation of a threonylcarbamoyl group on adenosine at position 37 (t(6)A37) in tRNAs that read codons beginning with adenine. Belongs to the KAE1 / YgjD family.
Protein type: EC 2.6.99.4; Protease
Chromosomal Location of Human Ortholog: 14q11.2
Research Articles on OSGEP
Similar Products
Product Notes
The OSGEP osgep (Catalog #AAA1275677) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccggcgg tgctgggttt tgaaggcagc gccaataaga ttggcgtggg cgtggtgcgg gatggcaagg tgctggcgaa cccgcggcgg acttacgtca cgcctcctgg cacaggattc cttccaggtg atacagccag gcatcaccga gctgttatcc tagacctgct gcaggaggca ctaacagagt ctggattaac ctcccaggat atcgactgca ttgcatacac caagggccct ggcatgggtg ccccactggt ttctgtggct gttgtggccc gtactgtggc ccaactgtgg aataagccat tggtgggtgt gaaccactgt ataggccaca ttgagatggg ccgcctcatc actggagcca ccagcccaac cgtgttgtat gtgagtggag gaaatacgca ggtgattgca tactcggaac atcgttaccg tatctttggg gaaaccatcg atattgcagt gggtaattgt ctggatcgtt ttgctcgagt gctgaagatt tctaacgacc caagtccagg atacaacatt gaacagatgg caaagcgagg caagaagcta gttgagctgc catacactgt aaaggggatg gacgtctcat tctcagggat cctgtctttc attgaggatg tagcccatcg gatgctggcc acaggcgagt gtactcctga ggatctgtgt ttctccctgc aggaaactgt gtttgcaatg ctggtagaga tcacagagcg agccatggca cattgtggct cccaggaggc cctcattgtg ggaggagtgg ggtgtaatgt gaggctacag gagatgatgg caacaatgtg ccaggaacgt ggagcccggc tttttgctac agatgagaga ttctgtattg acaatggagc gatgatagcc caggctggct gggagatgtt tcgggctgga cacaggaccc cactcagtga ttctggggtt acacagaggt atcggacaga tgaagtagag gtgacctgga gggactaa. It is sometimes possible for the material contained within the vial of "OSGEP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
