Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ORM1 cdna clone

ORM1 cDNA Clone

Gene Names
ORM1; ORM; AGP1; AGP-A; HEL-S-153w
Synonyms
ORM1; ORM1 cDNA Clone; ORM1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgctgtcctgggttcttacagtcctgagcctcctacctctgctggaagcccagatcccattgtgtgccaacctagtaccggtgcccatcaccaacgccaccctggaccggatcactggcaagtggttttatatcgcatcggcctttcgaaacgaggagtacaataagtcggttcaggagatccaagcaaccttcttttacttcacccccaacaagacagaggacacgatctttctcagagagtaccagacccgacaggaccagtgcatctataacaccacctacctgaatgtccagcgggaaaatgggaccatctccagatacgtgggaggccaagagcatttcgctcacttgctgatcctcagggacaccaagacctacatgcttgcttttgacgtgaacgatgagaagaactgggggctgtctgtctatgctgacaagccagagacgaccaaggagcaactgggagagttctacgaagctctcgactgcttgcgcattcccaagtcagatgtcgtgtacaccgattggaaaaaggataagtgtgagccactggagaagcagcacgagaaggagaggaaacaggaggagggggaatcctag
Sequence Length
606
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,512 Da
NCBI Official Full Name
Homo sapiens orosomucoid 1, mRNA
NCBI Official Synonym Full Names
orosomucoid 1
NCBI Official Symbol
ORM1
NCBI Official Synonym Symbols
ORM; AGP1; AGP-A; HEL-S-153w
NCBI Protein Information
alpha-1-acid glycoprotein 1
UniProt Protein Name
Alpha-1-acid glycoprotein 1
Protein Family
UniProt Gene Name
ORM1
UniProt Synonym Gene Names
AGP1; AGP 1; OMD 1
UniProt Entry Name
A1AG1_HUMAN

NCBI Description

This gene encodes a key acute phase plasma protein. Because of its increase due to acute inflammation, this protein is classified as an acute-phase reactant. The specific function of this protein has not yet been determined; however, it may be involved in aspects of immunosuppression. [provided by RefSeq, Jul 2008]

Uniprot Description

ORM1: Functions as transport protein in the blood stream. Binds various ligands in the interior of its beta-barrel domain. Also binds synthetic drugs and influences their distribution and availability in the body. Appears to function in modulating the activity of the immune system during the acute-phase reaction. Belongs to the calycin superfamily. Lipocalin family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 9q32

Cellular Component: extracellular region; extracellular space

Molecular Function: protein binding

Biological Process: inflammatory response; negative regulation of interleukin-6 production; negative regulation of tumor necrosis factor production; platelet degranulation

Research Articles on ORM1

Similar Products

Product Notes

The ORM1 orm1 (Catalog #AAA1273824) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgctgt cctgggttct tacagtcctg agcctcctac ctctgctgga agcccagatc ccattgtgtg ccaacctagt accggtgccc atcaccaacg ccaccctgga ccggatcact ggcaagtggt tttatatcgc atcggccttt cgaaacgagg agtacaataa gtcggttcag gagatccaag caaccttctt ttacttcacc cccaacaaga cagaggacac gatctttctc agagagtacc agacccgaca ggaccagtgc atctataaca ccacctacct gaatgtccag cgggaaaatg ggaccatctc cagatacgtg ggaggccaag agcatttcgc tcacttgctg atcctcaggg acaccaagac ctacatgctt gcttttgacg tgaacgatga gaagaactgg gggctgtctg tctatgctga caagccagag acgaccaagg agcaactggg agagttctac gaagctctcg actgcttgcg cattcccaag tcagatgtcg tgtacaccga ttggaaaaag gataagtgtg agccactgga gaagcagcac gagaaggaga ggaaacagga ggagggggaa tcctag. It is sometimes possible for the material contained within the vial of "ORM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.