Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

OR5P2 cdna clone

OR5P2 cDNA Clone

Gene Names
OR5P2; JCG3; JCG4
Synonyms
OR5P2; OR5P2 cDNA Clone; OR5P2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaattccctgaaggacgggaatcacaccgctctgacggggttcatcctattgggcttaacagatgatccaatccttcgagtcatcctcttcatgatcatcctatctggtaatctcagcataattattcttatcagaatttcttctcagctccatcatcctatgtatttctttctgagccacttggcttttgctgacatggcctattcatcttctgtcacacccaacatgcttgtaaacttcctggtggagagaaatacagtctcctaccttggatgtgccatccagcttggttcagcggctttctttgcaacagtcgaatgcgtccttctggctgccatggcctatgaccgctttgtggcaatttgcagtccactgctttattcaaccaaaatgtccacacaagtcagtgtccagctactcttagtagtttacatagctggttttctcattgctgtctcctatactacttccttctattttttactcttctgtggaccaaatcaagtcaatcattttttctgtgatttcgctcccttacttgaactctcctgttctgatatcagtgtctccacagttgttctctcattttcttctggatccatcattgtggtcactgtgtgtgtcatagccgtctgctacatctatatcctcatcaccatcctgaagatgcgctccactgaggggcaccacaaggccttctccacctgcacttcccacctcactgtggttaccctgttctatgggaccattaccttcatttatgtgatgcccaattttagctactcaactgaccagaacaaggtggtgtctgtgttgtacacagtggtgattcccatgttgaaccccctgatctacagcctcaggaacaaggagattaagggggctctgaagagagagcttgttagaaaaatactttctcatgatgcttgttattttagtagaacttcaaataatgatattacatag
Sequence Length
969
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,786 Da
NCBI Official Full Name
Homo sapiens olfactory receptor, family 5, subfamily P, member 2, mRNA
NCBI Official Synonym Full Names
olfactory receptor family 5 subfamily P member 2
NCBI Official Symbol
OR5P2
NCBI Official Synonym Symbols
JCG3; JCG4
NCBI Protein Information
olfactory receptor 5P2
UniProt Protein Name
Olfactory receptor 5P2
Protein Family
UniProt Gene Name
OR5P2
UniProt Entry Name
OR5P2_HUMAN

NCBI Description

Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Uniprot Description

OR5P2: Odorant receptor (Potential). May be involved in taste perception. Belongs to the G-protein coupled receptor 1 family.

Protein type: GPCR, family 1; Membrane protein, multi-pass; Membrane protein, integral; Receptor, GPCR

Chromosomal Location of Human Ortholog: 11p15.4

Cellular Component: plasma membrane

Molecular Function: odorant binding; olfactory receptor activity

Biological Process: G-protein coupled receptor protein signaling pathway

Similar Products

Product Notes

The OR5P2 or5p2 (Catalog #AAA1269055) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaattccc tgaaggacgg gaatcacacc gctctgacgg ggttcatcct attgggctta acagatgatc caatccttcg agtcatcctc ttcatgatca tcctatctgg taatctcagc ataattattc ttatcagaat ttcttctcag ctccatcatc ctatgtattt ctttctgagc cacttggctt ttgctgacat ggcctattca tcttctgtca cacccaacat gcttgtaaac ttcctggtgg agagaaatac agtctcctac cttggatgtg ccatccagct tggttcagcg gctttctttg caacagtcga atgcgtcctt ctggctgcca tggcctatga ccgctttgtg gcaatttgca gtccactgct ttattcaacc aaaatgtcca cacaagtcag tgtccagcta ctcttagtag tttacatagc tggttttctc attgctgtct cctatactac ttccttctat tttttactct tctgtggacc aaatcaagtc aatcattttt tctgtgattt cgctccctta cttgaactct cctgttctga tatcagtgtc tccacagttg ttctctcatt ttcttctgga tccatcattg tggtcactgt gtgtgtcata gccgtctgct acatctatat cctcatcacc atcctgaaga tgcgctccac tgaggggcac cacaaggcct tctccacctg cacttcccac ctcactgtgg ttaccctgtt ctatgggacc attaccttca tttatgtgat gcccaatttt agctactcaa ctgaccagaa caaggtggtg tctgtgttgt acacagtggt gattcccatg ttgaaccccc tgatctacag cctcaggaac aaggagatta agggggctct gaagagagag cttgttagaa aaatactttc tcatgatgct tgttatttta gtagaacttc aaataatgat attacatag. It is sometimes possible for the material contained within the vial of "OR5P2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.