Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

OPTN cdna clone

OPTN cDNA Clone

Gene Names
OPTN; NRP; FIP2; HIP7; HYPL; ALS12; GLC1E; TFIIIA-INTP
Synonyms
OPTN; OPTN cDNA Clone; OPTN cdna clone
Ordering
For Research Use Only!
Sequence
atgtcccatcaacctctcagctgcctcactgaaaaggaggacagccccagtgaaagcacaggaaatggacccccccacctggcccacccaaacctggacacgtttaccccggaggagctgctgcagcagatgaaagagctcctgaccgagaaccaccagctgaaagaagccatgaagctaaataatcaagccatgaaagggagatttgaggagctttcggcctggacagagaaacagaaggaagaacgccagttttttgagatacagagcaaagaagcaaaagagcgtctaatggccttgagtcatgagaatgagaaattgaaggaagagcttggaaaactaaaagggaaatcagaaaggtcatctgaggaccccactgatgactccaggcttcccagggccgaagcggagcaggaaaaggaccagctcaggacccaggtggtgaggctacaagcagagaaggcagacctgttgggcatcgtgtctgaactgcagctcaagctgaactccagcggctcctcagaagattcctttgttgaaattaggatggctgaaggagaagcagaagggtcagtaaaagaaatcaagcatagtcctgggcccacgagaacagtctccactggcacggcattgtctaaatataggagcagatctgcagatggggccaagaattacttcgaacatgaggagttaactgtgagccagctcctgctgtgcctaagggaagggaatcagaaggtggagagacttgaagttgcactcaaggaggccaaagaaagagtttcagattttgaaaagaaaacaagtaatcgttctgagattgaaacccagacagaggggagcacagagaaagagaatgatgaagagaaaggcccggagactgttggaagcgaagtggaagcactgaacctccaggtgacatctctgtttaaggagcttcaagaggctcatacaaaactcagcgaagctgagctaatgaagaagagacttcaagaaaagtgtcaggcccttgaaaggaaaaattctgcaattccatcagagttgaatgaaaagcaagagcttgtttatactaacaaaaagttagagctacaagtggaaagcatgctatcagaaatcaaaatggaacaggctaaaacagaggatgaaaagtccaaattaactgtgctacagatgacacacaacaagcttcttcaagaacataataatgcattgaaaacaattgaggaactaacaagaaaagagtcagaaaaagtggacagggcagtgctgaaggaactgagtgaaaaactggaactggcagagaaggctctggcttccaaacagctgcaaatggatgaaatgaagcaaaccattgccaagcaggaagaggacctggaaaccatgaccatcctcagggctcagatggaagtttactgttctgattttcatgctgaaagagcagcgagagagaaaattcatgaggaaaaggagcaactggcattgcagctggcagttctgctgaaagagaatgatgctttcgaagacggaggcaggcagtccttgatggagatgcagagtcgtcatggggcgagaacaagtgactctgaccagcaggcttaccttgttcaaagaggagctgaggacagggactggcggcaacagcggaatattccgattcattcctgccccaagtgtggagaggttctgcctgacatagacacgttacagattcacgtgatggattgcatcatttaa
Sequence Length
1734
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,559 Da
NCBI Official Full Name
Homo sapiens optineurin, mRNA
NCBI Official Synonym Full Names
optineurin
NCBI Official Symbol
OPTN
NCBI Official Synonym Symbols
NRP; FIP2; HIP7; HYPL; ALS12; GLC1E; TFIIIA-INTP
NCBI Protein Information
optineurin
UniProt Protein Name
Optineurin
Protein Family
UniProt Gene Name
OPTN
UniProt Synonym Gene Names
FIP2; GLC1E; HIP7; HYPL; NRP; HIP-7; TFIIIA-IntP
UniProt Entry Name
OPTN_HUMAN

NCBI Description

This gene encodes the coiled-coil containing protein optineurin. Optineurin may play a role in normal-tension glaucoma and adult-onset primary open angle glaucoma. Optineurin interacts with adenovirus E3-14.7K protein and may utilize tumor necrosis factor-alpha or Fas-ligand pathways to mediate apoptosis, inflammation or vasoconstriction. Optineurin may also function in cellular morphogenesis and membrane trafficking, vesicle trafficking, and transcription activation through its interactions with the RAB8, huntingtin, and transcription factor IIIA proteins. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]

Uniprot Description

optineurin: Plays an important role in the maintenance of the Golgi complex, in membrane trafficking, in exocytosis, through its interaction with myosin VI and Rab8. Links myosin VI to the Golgi complex and plays an important role in Golgi ribbon formation. Negatively regulates the induction of IFNB in response to RNA virus infection. Plays a neuroprotective role in the eye and optic nerve. Probably part of the TNF-alpha signaling pathway that can shift the equilibrium toward induction of cell death. May act by regulating membrane trafficking and cellular morphogenesis via a complex that contains Rab8 and hungtingtin (HD). May constitute a cellular target for adenovirus E3 14.7, an inhibitor of TNF-alpha functions, thereby affecting cell death. Defects in OPTN are the cause of primary open angle glaucoma type 1E (GLC1E). Primary open angle glaucoma (POAG) is characterized by a specific pattern of optic nerve and visual field defects. The angle of the anterior chamber of the eye is open, and usually the intraocular pressure is increased. The disease is asymptomatic until the late stages, by which time significant and irreversible optic nerve damage has already taken place. Defects in OPTN are a cause of susceptibility to normal pressure glaucoma (NPG). Defects in OPTN are the cause of amyotrophic lateral sclerosis type 12 (ALS12). It is a neurodegenerative disorder affecting upper motor neurons in the brain and lower motor neurons in the brain stem and spinal cord, resulting in fatal paralysis. Sensory abnormalities are absent. Death usually occurs within 2 to 5 years. The etiology of amyotrophic lateral sclerosis is likely to be multifactorial, involving both genetic and environmental factors. The disease is inherited in 5-10% of the cases. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Inhibitor

Chromosomal Location of Human Ortholog: 10p13

Cellular Component: cytoplasm; cytoplasmic membrane-bound vesicle; cytosol; Golgi apparatus; Golgi membrane; nucleoplasm; nucleus; trans-Golgi network

Molecular Function: identical protein binding; polyubiquitin binding; protein binding; protein binding, bridging; protein C-terminus binding; Rab GTPase binding

Biological Process: cell death; defense response to Gram-negative bacterium; G2/M transition of mitotic cell cycle; Golgi organization and biogenesis; Golgi to plasma membrane protein transport; macroautophagy; negative regulation of receptor recycling; protein targeting to Golgi; regulation of I-kappaB kinase/NF-kappaB cascade; signal transduction

Disease: Amyotrophic Lateral Sclerosis 12; Glaucoma, Normal Tension, Susceptibility To; Glaucoma, Primary Open Angle

Research Articles on OPTN

Similar Products

Product Notes

The OPTN optn (Catalog #AAA1276791) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcccatc aacctctcag ctgcctcact gaaaaggagg acagccccag tgaaagcaca ggaaatggac ccccccacct ggcccaccca aacctggaca cgtttacccc ggaggagctg ctgcagcaga tgaaagagct cctgaccgag aaccaccagc tgaaagaagc catgaagcta aataatcaag ccatgaaagg gagatttgag gagctttcgg cctggacaga gaaacagaag gaagaacgcc agttttttga gatacagagc aaagaagcaa aagagcgtct aatggccttg agtcatgaga atgagaaatt gaaggaagag cttggaaaac taaaagggaa atcagaaagg tcatctgagg accccactga tgactccagg cttcccaggg ccgaagcgga gcaggaaaag gaccagctca ggacccaggt ggtgaggcta caagcagaga aggcagacct gttgggcatc gtgtctgaac tgcagctcaa gctgaactcc agcggctcct cagaagattc ctttgttgaa attaggatgg ctgaaggaga agcagaaggg tcagtaaaag aaatcaagca tagtcctggg cccacgagaa cagtctccac tggcacggca ttgtctaaat ataggagcag atctgcagat ggggccaaga attacttcga acatgaggag ttaactgtga gccagctcct gctgtgccta agggaaggga atcagaaggt ggagagactt gaagttgcac tcaaggaggc caaagaaaga gtttcagatt ttgaaaagaa aacaagtaat cgttctgaga ttgaaaccca gacagagggg agcacagaga aagagaatga tgaagagaaa ggcccggaga ctgttggaag cgaagtggaa gcactgaacc tccaggtgac atctctgttt aaggagcttc aagaggctca tacaaaactc agcgaagctg agctaatgaa gaagagactt caagaaaagt gtcaggccct tgaaaggaaa aattctgcaa ttccatcaga gttgaatgaa aagcaagagc ttgtttatac taacaaaaag ttagagctac aagtggaaag catgctatca gaaatcaaaa tggaacaggc taaaacagag gatgaaaagt ccaaattaac tgtgctacag atgacacaca acaagcttct tcaagaacat aataatgcat tgaaaacaat tgaggaacta acaagaaaag agtcagaaaa agtggacagg gcagtgctga aggaactgag tgaaaaactg gaactggcag agaaggctct ggcttccaaa cagctgcaaa tggatgaaat gaagcaaacc attgccaagc aggaagagga cctggaaacc atgaccatcc tcagggctca gatggaagtt tactgttctg attttcatgc tgaaagagca gcgagagaga aaattcatga ggaaaaggag caactggcat tgcagctggc agttctgctg aaagagaatg atgctttcga agacggaggc aggcagtcct tgatggagat gcagagtcgt catggggcga gaacaagtga ctctgaccag caggcttacc ttgttcaaag aggagctgag gacagggact ggcggcaaca gcggaatatt ccgattcatt cctgccccaa gtgtggagag gttctgcctg acatagacac gttacagatt cacgtgatgg attgcatcat ttaa. It is sometimes possible for the material contained within the vial of "OPTN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.