Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

OLFM4 cdna clone

OLFM4 cDNA Clone

Gene Names
OLFM4; GC1; OLM4; OlfD; GW112; hGC-1; hOLfD; UNQ362; bA209J19.1
Synonyms
OLFM4; OLFM4 cDNA Clone; OLFM4 cdna clone
Ordering
For Research Use Only!
Sequence
atgaggcccggcctctcatttctcctagcccttctgttcttccttggccaagctgcaggggatttgggggatgtgggacctccaattcccagccccggcttcagctctttcccaggtgttgactccagctccagcttcagctccagctccaggtcgggctccagctccagccgcagcttaggcagcggaggttctgtgtcccagttgttttccaatttcaccggctccgtggatgaccgtgggacctgccagtgctctgtttccctgccagacaccacctttcccgtggacagagtggaacgcttggaattcacagctcatgttctttctcagaagtttgagaaagaactttccaaagtgagggaatatgtccaattaattagtgtgtatgaaaagaaactgttaaacctaactgtccgaattgacatcatggagaaggataccatttcttacactgaactggacttcgagctgatcaaggtagaagtgaaggagatggaaaaactggtcatacagctgaaggagagttttggtggaagctcagaaattgttgaccagctggaggtggagataagaaatatgactctcttggtagagaagcttgagacactagacaaaaacaatgtccttgccattcgccgagaaatcgtggctctgaagaccaagctgaaagagtgtgaggcctctaaagatcaaaacacccctgtcgtccaccctcctcccactccagggagctgtggtcatggtggtgtggtgaacatcagcaaaccgtctgtggttcagctcaactggagagggttttcttatctatatggtgcttggggtagggattactctccccagcatccaaacaaaggactgtattgggtggcgccattgaatacagatgggagactgttggagtattatagactgtacaacacactggatgatttgctattgtatataaatgctcgagagttgcggatcacctatggccaaggtagtggtacagcagtttacaacaacaacatgtacgtcaacatgtacaacaccgggaatattgccagagttaacctgaccaccaacacgattgctgtgactcaaactctccctaatgctgcctataataaccgcttttcatatgctaatgttgcttggcaagatattgactttgctgtggatgagaatggattgtgggttatttattcaactgaagccagcactggtaacatggtgattagtaaactcaatgacaccacacttcaggtgctaaacacttggtataccaagcagtataaaccatctgcttctaacgccttcatggtatgtggggttctgtatgccacccgtactatgaacaccagaacagaagagattttttactattatgacacaaacacagggaaagagggcaaactagacattgtaatgcataagatgcaggaaaaagtgcagagcattaactataacccttttgaccagaaactttatgtctataacgatggttaccttctgaattatgatctttctgtcttgcagaagccccagtaa
Sequence Length
1533
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,280 Da
NCBI Official Full Name
Homo sapiens olfactomedin 4, mRNA
NCBI Official Synonym Full Names
olfactomedin 4
NCBI Official Symbol
OLFM4
NCBI Official Synonym Symbols
GC1; OLM4; OlfD; GW112; hGC-1; hOLfD; UNQ362; bA209J19.1
NCBI Protein Information
olfactomedin-4
UniProt Protein Name
Olfactomedin-4
Protein Family
UniProt Gene Name
OLFM4
UniProt Synonym Gene Names
GW112; OLM4; hGC-1
UniProt Entry Name
OLFM4_HUMAN

NCBI Description

This gene was originally cloned from human myeloblasts and found to be selectively expressed in inflammed colonic epithelium. This gene encodes a member of the olfactomedin family. The encoded protein is an antiapoptotic factor that promotes tumor growth and is an extracellular matrix glycoprotein that facilitates cell adhesion. [provided by RefSeq, Mar 2011]

Uniprot Description

OLFM4: May promote proliferation of pancreatic cancer cells by favoring the transition from the S to G2/M phase. In myeloid leukemic cell lines, inhibits cell growth and induces cell differentiation and apoptosis. May play a role in the inhibition of EIF4EBP1 phosphorylation/deactivation. Facilitates cell adhesion, most probably through interaction with cell surface lectins and cadherin.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 13q14.3

Cellular Component: azurophil granule; extracellular space; perinuclear region of cytoplasm; plasma membrane; secretory granule; specific granule

Molecular Function: cadherin binding; protein binding; protein homodimerization activity

Biological Process: protein homooligomerization; regulation of apoptosis; regulation of phagocytosis

Research Articles on OLFM4

Similar Products

Product Notes

The OLFM4 olfm4 (Catalog #AAA1272855) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggcccg gcctctcatt tctcctagcc cttctgttct tccttggcca agctgcaggg gatttggggg atgtgggacc tccaattccc agccccggct tcagctcttt cccaggtgtt gactccagct ccagcttcag ctccagctcc aggtcgggct ccagctccag ccgcagctta ggcagcggag gttctgtgtc ccagttgttt tccaatttca ccggctccgt ggatgaccgt gggacctgcc agtgctctgt ttccctgcca gacaccacct ttcccgtgga cagagtggaa cgcttggaat tcacagctca tgttctttct cagaagtttg agaaagaact ttccaaagtg agggaatatg tccaattaat tagtgtgtat gaaaagaaac tgttaaacct aactgtccga attgacatca tggagaagga taccatttct tacactgaac tggacttcga gctgatcaag gtagaagtga aggagatgga aaaactggtc atacagctga aggagagttt tggtggaagc tcagaaattg ttgaccagct ggaggtggag ataagaaata tgactctctt ggtagagaag cttgagacac tagacaaaaa caatgtcctt gccattcgcc gagaaatcgt ggctctgaag accaagctga aagagtgtga ggcctctaaa gatcaaaaca cccctgtcgt ccaccctcct cccactccag ggagctgtgg tcatggtggt gtggtgaaca tcagcaaacc gtctgtggtt cagctcaact ggagagggtt ttcttatcta tatggtgctt ggggtaggga ttactctccc cagcatccaa acaaaggact gtattgggtg gcgccattga atacagatgg gagactgttg gagtattata gactgtacaa cacactggat gatttgctat tgtatataaa tgctcgagag ttgcggatca cctatggcca aggtagtggt acagcagttt acaacaacaa catgtacgtc aacatgtaca acaccgggaa tattgccaga gttaacctga ccaccaacac gattgctgtg actcaaactc tccctaatgc tgcctataat aaccgctttt catatgctaa tgttgcttgg caagatattg actttgctgt ggatgagaat ggattgtggg ttatttattc aactgaagcc agcactggta acatggtgat tagtaaactc aatgacacca cacttcaggt gctaaacact tggtatacca agcagtataa accatctgct tctaacgcct tcatggtatg tggggttctg tatgccaccc gtactatgaa caccagaaca gaagagattt tttactatta tgacacaaac acagggaaag agggcaaact agacattgta atgcataaga tgcaggaaaa agtgcagagc attaactata acccttttga ccagaaactt tatgtctata acgatggtta ccttctgaat tatgatcttt ctgtcttgca gaagccccag taa. It is sometimes possible for the material contained within the vial of "OLFM4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.