Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

OBFC2B cdna clone

OBFC2B cDNA Clone

Gene Names
NABP2; SSB1; hSSB1; OBFC2B; SOSS-B1
Synonyms
OBFC2B; OBFC2B cDNA Clone; OBFC2B cdna clone
Ordering
For Research Use Only!
Sequence
atgacgacggagacctttgtgaaggatatcaagcctgggctcaagaatctgaaccttatcttcattgtgctggagacaggccgagtgaccaagacaaaggacgggcatgaggttcggacctgcaaagtggcggacaaaacaggcagcatcaatatctctgtctgggacgatgttggcaatctgatccagcctggggacattatccggctcaccaaagggtacgcttcagttttcaaaggttgtctgacactatatactggccgtgggggtgatctgcagaagattggagaattctgtatggtttattctgaggttcctaacttcagtgagccaaacccagagtacagcacccagcaggcacccaacaaggcggtgcagaacgacagcaacccttcagcttcccagcctaccactggaccctctgctgcctctccagcctctgagaaccagaatgggaatggactgagtgccccaccaggtcccggtggtggcccacatccccctcatactccctcccacccacccagcacccgaatcactcgaagccagcccaaccacacacctgcaggcccgcctggcccttccagcaaccctgttagtaacggcaaagaaacccggaggagcagcaagagatag
Sequence Length
636
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
11,493 Da
NCBI Official Full Name
Homo sapiens oligonucleotide/oligosaccharide-binding fold containing 2B, mRNA
NCBI Official Synonym Full Names
nucleic acid binding protein 2
NCBI Official Symbol
NABP2
NCBI Official Synonym Symbols
SSB1; hSSB1; OBFC2B; SOSS-B1
NCBI Protein Information
SOSS complex subunit B1
UniProt Protein Name
SOSS complex subunit B1
UniProt Gene Name
NABP2
UniProt Synonym Gene Names
OBFC2B; SSB1; SOSS-B1; hSSB1
UniProt Entry Name
SOSB1_HUMAN

NCBI Description

Single-stranded DNA (ssDNA)-binding proteins, such as OBFC2B, are ubiquitous and essential for a variety of DNA metabolic processes, including replication, recombination, and detection and repair of damage (Richard et al., 2008 [PubMed 18449195]).[supplied by OMIM, Jun 2008]

Uniprot Description

OBFC2B: Component of the SOSS complex, a multiprotein complex that functions downstream of the MRN complex to promote DNA repair and G2/M checkpoint. In the SOSS complex, acts as a sensor of single-stranded DNA that binds to single-stranded DNA, in particular to polypyrimidines. The SOSS complex associates with DNA lesions and influences diverse endpoints in the cellular DNA damage response including cell-cycle checkpoint activation, recombinational repair and maintenance of genomic stability. Required for efficient homologous recombination-dependent repair of double-strand breaks (DSBs) and ATM-dependent signaling pathways. Component of the SOSS complex, composed of SOSS-B (SOSS- B1/OBFC2B or SOSS-B2/OBFC2A), SOSS-A/INTS3 and SOSS-C/C9orf80. SOSS complexes containing SOSS-B1/OBFC2B are more abundant than complexes containing SOSS-B2/OBFC2A. Directly interacts with ATM, SOSS-A/INTS3 and RAD51. Interacts with INTS7. Belongs to the SOSS-B family. SOSS-B1 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell cycle regulation; DNA repair, damage

Chromosomal Location of Human Ortholog: 12q13.3

Cellular Component: cytoplasm; nuclear chromosome, telomeric region; nucleoplasm; nucleus

Molecular Function: enzyme binding; protein binding; single-stranded DNA binding

Biological Process: DNA repair; double-strand break repair via homologous recombination; mitotic cell cycle checkpoint; regulation of telomerase activity; response to DNA damage stimulus; response to ionizing radiation; snRNA transcription from RNA polymerase II promoter

Research Articles on OBFC2B

Similar Products

Product Notes

The OBFC2B nabp2 (Catalog #AAA1278229) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacgacgg agacctttgt gaaggatatc aagcctgggc tcaagaatct gaaccttatc ttcattgtgc tggagacagg ccgagtgacc aagacaaagg acgggcatga ggttcggacc tgcaaagtgg cggacaaaac aggcagcatc aatatctctg tctgggacga tgttggcaat ctgatccagc ctggggacat tatccggctc accaaagggt acgcttcagt tttcaaaggt tgtctgacac tatatactgg ccgtgggggt gatctgcaga agattggaga attctgtatg gtttattctg aggttcctaa cttcagtgag ccaaacccag agtacagcac ccagcaggca cccaacaagg cggtgcagaa cgacagcaac ccttcagctt cccagcctac cactggaccc tctgctgcct ctccagcctc tgagaaccag aatgggaatg gactgagtgc cccaccaggt cccggtggtg gcccacatcc ccctcatact ccctcccacc cacccagcac ccgaatcact cgaagccagc ccaaccacac acctgcaggc ccgcctggcc cttccagcaa ccctgttagt aacggcaaag aaacccggag gagcagcaag agatag. It is sometimes possible for the material contained within the vial of "OBFC2B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.