Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

OBFC1 cdna clone

OBFC1 cDNA Clone

Gene Names
OBFC1; STN1; AAF44; AAF-44; RPA-32; bA541N10.2
Synonyms
OBFC1; OBFC1 cDNA Clone; OBFC1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcagcctggatccagccggtgtgaagaggagaccccttccctcttgtggggtttggatcctgtgtttctagcctttgcaaaactctacatcagggatatcctggacatgaaggagtcccgccaggtgccaggtgtatttttgtacaatggacatccaataaaacaggtagatgtcttgggaactgtcattggagtgagagaaagagatgctttctacagttatggagtggatgacagcactggagttataaactgcatctgctggaaaaagttgaatactgagtctgtatcagctgctcctagtgcagcaagagagctcagcttaacctcacaacttaagaagctacaagagaccattgagcagaaaacaaagatagagatcggggacacgatccgagtcagaggcagtatccgcacatacagagaagagcgagagattcatgccaccgcttactataaagtggacgacccagtgtggaacattcaaattgcaaggatgcttgagctgcccactatctacaggaaagtttatgaccagccttttcacagctcagccctagagaaagaagaggcactaagcaatccaggcgccctggacctccccagtctcacgagtttgctgagtgaaaaagccaaagaattcctcatggagaacagagtgcagagcttttaccagcaggagctggaaatggtggagtctttgctgtcccttgccaatcagcctgtgattcacagtgcctgctccgaccaagtgaattttaagaaggacaccacttccaaggcaattcatagtatatttaagaatgctatacaactgctgcaggaaaaaggacttgttttccagaaagatgatggttttgataacctatactatgtaaccagagaagacaaagacctgcacagaaagatccaccggatcattcagcaggactgccagaaaccaaatcacatggagaagggctgtcacttcctgcacatcttggcctgtgctcgcctgagcatccgcccgggcctgagcgaggctgtgctgcagcaagttctggagctcctggaggaccagagtgacattgtcagcacaatggagcactactacacagcgttctga
Sequence Length
1107
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,119 Da
NCBI Official Full Name
Homo sapiens oligonucleotide/oligosaccharide-binding fold containing 1, mRNA
NCBI Official Synonym Full Names
oligonucleotide/oligosaccharide binding fold containing 1
NCBI Official Symbol
OBFC1
NCBI Official Synonym Symbols
STN1; AAF44; AAF-44; RPA-32; bA541N10.2
NCBI Protein Information
CST complex subunit STN1
UniProt Protein Name
CST complex subunit STN1
Protein Family
UniProt Gene Name
OBFC1
UniProt Synonym Gene Names
STN1
UniProt Entry Name
STN1_HUMAN

NCBI Description

OBFC1 and C17ORF68 (MIM 613129) are subunits of an alpha accessory factor (AAF) that stimulates the activity of DNA polymerase-alpha-primase (see MIM 176636), the enzyme that initiates DNA replication (Casteel et al., 2009 [PubMed 19119139]). OBFC1 also appears to function in a telomere-associated complex with C17ORF68 and TEN1 (C17ORF106; MIM 613130) (Miyake et al., 2009 [PubMed 19854130]).[supplied by OMIM, Nov 2009]

Uniprot Description

OBFC1: Component of the CST complex, a complex that binds to single-stranded DNA and is required to protect telomeres from DNA degradation. The CST complex binds single-stranded DNA with high affinity in a sequence-independent manner, while isolated subunits bind DNA with low affinity by themselves. In addition to telomere protection, the CST complex has probably a more general role in DNA metabolism at non-telomeric sites. Belongs to the STN1 family.

Chromosomal Location of Human Ortholog: 10q24.33

Cellular Component: intermediate filament cytoskeleton; intracellular membrane-bound organelle; nuclear chromosome, telomeric region; nucleolus; nucleoplasm; nucleus

Molecular Function: protein binding; single-stranded DNA binding; single-stranded telomeric DNA binding; telomeric DNA binding

Biological Process: negative regulation of telomerase activity; positive regulation of DNA replication; positive regulation of telomerase activity; positive regulation of telomere maintenance via telomerase; telomere maintenance

Research Articles on OBFC1

Similar Products

Product Notes

The OBFC1 obfc1 (Catalog #AAA1275680) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagcctg gatccagccg gtgtgaagag gagacccctt ccctcttgtg gggtttggat cctgtgtttc tagcctttgc aaaactctac atcagggata tcctggacat gaaggagtcc cgccaggtgc caggtgtatt tttgtacaat ggacatccaa taaaacaggt agatgtcttg ggaactgtca ttggagtgag agaaagagat gctttctaca gttatggagt ggatgacagc actggagtta taaactgcat ctgctggaaa aagttgaata ctgagtctgt atcagctgct cctagtgcag caagagagct cagcttaacc tcacaactta agaagctaca agagaccatt gagcagaaaa caaagataga gatcggggac acgatccgag tcagaggcag tatccgcaca tacagagaag agcgagagat tcatgccacc gcttactata aagtggacga cccagtgtgg aacattcaaa ttgcaaggat gcttgagctg cccactatct acaggaaagt ttatgaccag ccttttcaca gctcagccct agagaaagaa gaggcactaa gcaatccagg cgccctggac ctccccagtc tcacgagttt gctgagtgaa aaagccaaag aattcctcat ggagaacaga gtgcagagct tttaccagca ggagctggaa atggtggagt ctttgctgtc ccttgccaat cagcctgtga ttcacagtgc ctgctccgac caagtgaatt ttaagaagga caccacttcc aaggcaattc atagtatatt taagaatgct atacaactgc tgcaggaaaa aggacttgtt ttccagaaag atgatggttt tgataaccta tactatgtaa ccagagaaga caaagacctg cacagaaaga tccaccggat cattcagcag gactgccaga aaccaaatca catggagaag ggctgtcact tcctgcacat cttggcctgt gctcgcctga gcatccgccc gggcctgagc gaggctgtgc tgcagcaagt tctggagctc ctggaggacc agagtgacat tgtcagcaca atggagcact actacacagc gttctga. It is sometimes possible for the material contained within the vial of "OBFC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.