Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NXF1 cdna clone

NXF1 cDNA Clone

Gene Names
NXF1; TAP; MEX67
Synonyms
NXF1; NXF1 cDNA Clone; NXF1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggacgaggggaagtcgtacagcgaacacgatgatgaacgcgttaatttccctcaaagaaagaagaaaggccggggtcccttccggtggaaatatggtgaaggaaaccgtaggtctggaagaggcggttctggtattcggtcttcccgccttgaggaagatgatggagatgtggcaatgagtgatgcccaggatggtccccgagtacgatacaacccctataccacccgacctaaccgtcggggtgatacttggcatgatcgagatcgcattcatgttactgtgcggagagacagagctcctccagagagaggaggggctggcaccagccaggatgggacctcaaagaactggttcaagattacaattccttatggcagaaagtatgacaaggcatggctcctgagcatgattcagagcaagtgcagtgtgcccttcacccctattgagtttcactatgagaatacacgggcccagttcttcgttgaagacgccagtactgcctctgcattgaaggctgtcaactataagattttggatcgggagaaccgaaggatatctatcatcatcaactcttctgctccaccccacactatactgaatgaactgaagccagaacaagtagaacagctaaagctgatcatgagcaaacgatacgatggctcccaacaagcccttgacctcaaaggcctccgttcagacccagatttggtggcccagaacattgacgttgtcctgaatcgcagaagctgtatggcagctaccctgaggatcattgaagagaacatccctgagctattgtccttgaacttgagcaacaacaggctgtacaggctggatgacatgtctagcattgttcagaaggcacccaacctgaagatcctaaacctttctggaaatgaattgaagtctgagcgggaattggacaagataaaggggctgaagctagaagagctctggctcgatggaaactccctgtgtgacaccttccgagaccagtccacctacatcagcgccattcgcgaacgatttcccaagttactacgcctggatggccatgagctacccccaccaattgcctttgatgttgaagcccccacgacgttaccgccctgcaagggaagctattttggaacagaaaacttgaagagtctggtcttgcacttcctgcaacagtactatgcaatttacgactctggagaccgacaagggctcctggatgcctaccatgatggggcctgctgttccctgagcattcctttcattcctcagaaccctgcccgaagcagcttagccgagtatttcaaggatagcagaaatgtgaagaagcttaaagaccctaccttgcggttccggctgctgaagcacacgcgtctcaacgttgttgccttcctcaatgagttgcccaaaacccagcacgacgtcaattccttcgtggtagacataagcgcccagacaagcacattgctgtgtttttctgtcaatggagtcttcaaggaagtggacggaaagtcccgggattctttgcgagccttcacccggacattcattgctgttcctgctagcaattcagggctatgtattgtaaatgatgagctatttgtgcggaatgccagttctgaagagatccaaagagccttcgctatgcctgcacccacgccttcctccagcccggtgcccaccctctctccagagcagcaggaaatgttgcaagcattctctacccagtctggcatgaacctcgagtggtcccagaagtgccttcaggacaacaactgggactacaccagatctgcccaggccttcactcatctcaaggccaagggcgagatcccagaagtggcattcatgaagtga
Sequence Length
1860
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,476 Da
NCBI Official Full Name
Homo sapiens nuclear RNA export factor 1, mRNA
NCBI Official Synonym Full Names
nuclear RNA export factor 1
NCBI Official Symbol
NXF1
NCBI Official Synonym Symbols
TAP; MEX67
NCBI Protein Information
nuclear RNA export factor 1
UniProt Protein Name
Nuclear RNA export factor 1
Protein Family
UniProt Gene Name
NXF1
UniProt Synonym Gene Names
TAP
UniProt Entry Name
NXF1_HUMAN

NCBI Description

This gene is one member of a family of nuclear RNA export factor genes. Common domain features of this family are a noncanonical RNP-type RNA-binding domain (RBD), 4 leucine-rich repeats (LRRs), a nuclear transport factor 2 (NTF2)-like domain that allows heterodimerization with NTF2-related export protein-1 (NXT1), and a ubiquitin-associated domain that mediates interactions with nucleoporins. The LRRs and NTF2-like domains are required for export activity. Alternative splicing seems to be a common mechanism in this gene family. The encoded protein of this gene shuttles between the nucleus and the cytoplasm and binds in vivo to poly(A)+ RNA. It is the vertebrate homologue of the yeast protein Mex67p. The encoded protein overcomes the mRNA export block caused by the presence of saturating amounts of CTE (constitutive transport element) RNA of type D retroviruses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]

Uniprot Description

NXF1: Involved in the nuclear export of mRNA species bearing retroviral constitutive transport elements (CTE) and in the export of mRNA from the nucleus to the cytoplasm. The NXF1-NXT1 heterodimer is involved in the export of HSP70 mRNA in conjunction with ALYREF/THOC4 and THOC5. Belongs to the NXF family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA-binding

Chromosomal Location of Human Ortholog: 11q12-q13

Cellular Component: cytosol; nuclear speck; nucleoplasm; nucleus

Molecular Function: protein binding; single-stranded RNA binding

Biological Process: mRNA export from nucleus; poly(A)+ mRNA export from nucleus; RNA export from nucleus

Research Articles on NXF1

Similar Products

Product Notes

The NXF1 nxf1 (Catalog #AAA1274751) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggacg aggggaagtc gtacagcgaa cacgatgatg aacgcgttaa tttccctcaa agaaagaaga aaggccgggg tcccttccgg tggaaatatg gtgaaggaaa ccgtaggtct ggaagaggcg gttctggtat tcggtcttcc cgccttgagg aagatgatgg agatgtggca atgagtgatg cccaggatgg tccccgagta cgatacaacc cctataccac ccgacctaac cgtcggggtg atacttggca tgatcgagat cgcattcatg ttactgtgcg gagagacaga gctcctccag agagaggagg ggctggcacc agccaggatg ggacctcaaa gaactggttc aagattacaa ttccttatgg cagaaagtat gacaaggcat ggctcctgag catgattcag agcaagtgca gtgtgccctt cacccctatt gagtttcact atgagaatac acgggcccag ttcttcgttg aagacgccag tactgcctct gcattgaagg ctgtcaacta taagattttg gatcgggaga accgaaggat atctatcatc atcaactctt ctgctccacc ccacactata ctgaatgaac tgaagccaga acaagtagaa cagctaaagc tgatcatgag caaacgatac gatggctccc aacaagccct tgacctcaaa ggcctccgtt cagacccaga tttggtggcc cagaacattg acgttgtcct gaatcgcaga agctgtatgg cagctaccct gaggatcatt gaagagaaca tccctgagct attgtccttg aacttgagca acaacaggct gtacaggctg gatgacatgt ctagcattgt tcagaaggca cccaacctga agatcctaaa cctttctgga aatgaattga agtctgagcg ggaattggac aagataaagg ggctgaagct agaagagctc tggctcgatg gaaactccct gtgtgacacc ttccgagacc agtccaccta catcagcgcc attcgcgaac gatttcccaa gttactacgc ctggatggcc atgagctacc cccaccaatt gcctttgatg ttgaagcccc cacgacgtta ccgccctgca agggaagcta ttttggaaca gaaaacttga agagtctggt cttgcacttc ctgcaacagt actatgcaat ttacgactct ggagaccgac aagggctcct ggatgcctac catgatgggg cctgctgttc cctgagcatt cctttcattc ctcagaaccc tgcccgaagc agcttagccg agtatttcaa ggatagcaga aatgtgaaga agcttaaaga ccctaccttg cggttccggc tgctgaagca cacgcgtctc aacgttgttg ccttcctcaa tgagttgccc aaaacccagc acgacgtcaa ttccttcgtg gtagacataa gcgcccagac aagcacattg ctgtgttttt ctgtcaatgg agtcttcaag gaagtggacg gaaagtcccg ggattctttg cgagccttca cccggacatt cattgctgtt cctgctagca attcagggct atgtattgta aatgatgagc tatttgtgcg gaatgccagt tctgaagaga tccaaagagc cttcgctatg cctgcaccca cgccttcctc cagcccggtg cccaccctct ctccagagca gcaggaaatg ttgcaagcat tctctaccca gtctggcatg aacctcgagt ggtcccagaa gtgccttcag gacaacaact gggactacac cagatctgcc caggccttca ctcatctcaa ggccaagggc gagatcccag aagtggcatt catgaagtga. It is sometimes possible for the material contained within the vial of "NXF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.