Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NUP62CL cdna clone

NUP62CL cDNA Clone

Synonyms
NUP62CL; NUP62CL cDNA Clone; NUP62CL cdna clone
Ordering
For Research Use Only!
Sequence
atgcagtttacctcaatatcaaattctttgacctccactgctgctattgggctctcatttacaacttcaacgactaccaccgccactttcaccaccaacactactaccacaatcaccagtggctttactgtgaaccaaaaccaactgttatcaagagggtttgaaaaccttgtaccttatacttcaactgttagtgtagtagcaactcctgtgatgacatatggtcatctggagggtcttataaatgagtggaaccttgagctggaagatcaagagaagtactttcttctccaggccactcaggtcaatgcttgggaccatacattgattgagaatggtgagatgattcgtattttacatggagaagtgaacaaagtgaaactggatcagaaaagattggaacaagaattggattttatcctgtcacagcagcaggaactagaatttctgttgacttatttagaggagtctacgcgtgaccagagtggacttcattatctgcaggatgcagatgaggagcatgtggagatctccaccagatctgcagaattctga
Sequence Length
555
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
7,880 Da
NCBI Official Full Name
Homo sapiens nucleoporin 62kDa C-terminal like, mRNA
NCBI Official Synonym Full Names
nucleoporin 62 C-terminal like
NCBI Official Symbol
NUP62CL
NCBI Protein Information
nucleoporin-62 C-terminal-like protein
UniProt Protein Name
Nucleoporin-62 C-terminal-like protein
UniProt Gene Name
NUP62CL
UniProt Synonym Gene Names
NUP62L
UniProt Entry Name
N62CL_HUMAN

NCBI Description

This gene encodes a protein containing a domain found in nucleoporins which are glycoproteins found in nuclear pore complexes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]

Uniprot Description

NUP62CL: a protein containing a domain found in nucleoporins which are glycoproteins found in nuclear pore complexes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]

Protein type: Nucleoporin

Chromosomal Location of Human Ortholog: Xq22.3

Molecular Function: nucleocytoplasmic transporter activity; phospholipid binding; protein binding; structural constituent of nuclear pore

Biological Process: protein import into nucleus; RNA export from nucleus

Similar Products

Product Notes

The NUP62CL nup62cl (Catalog #AAA1274047) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagttta cctcaatatc aaattctttg acctccactg ctgctattgg gctctcattt acaacttcaa cgactaccac cgccactttc accaccaaca ctactaccac aatcaccagt ggctttactg tgaaccaaaa ccaactgtta tcaagagggt ttgaaaacct tgtaccttat acttcaactg ttagtgtagt agcaactcct gtgatgacat atggtcatct ggagggtctt ataaatgagt ggaaccttga gctggaagat caagagaagt actttcttct ccaggccact caggtcaatg cttgggacca tacattgatt gagaatggtg agatgattcg tattttacat ggagaagtga acaaagtgaa actggatcag aaaagattgg aacaagaatt ggattttatc ctgtcacagc agcaggaact agaatttctg ttgacttatt tagaggagtc tacgcgtgac cagagtggac ttcattatct gcaggatgca gatgaggagc atgtggagat ctccaccaga tctgcagaat tctga. It is sometimes possible for the material contained within the vial of "NUP62CL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.