Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NUP160 cdna clone

NUP160 cDNA Clone

Synonyms
NUP160; NUP160 cDNA Clone; NUP160 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggcgggagccctggaacggagcttcgtggagctaagcggagctgagcgcgaaaggccgaggcactttcgggaattcacagtctgcagcattgggactgcaaatgccgtggctggcgccgtaaaatacagtgaaagcgcgggaggcttttactacgtggagagtggcaagttgttctccgtaaccagaaacaggttcattcattggaagacctctggagatacattggagctgatggaggagtcactggacataaatctgttgaataatgccattcgcctaaaattccaaaattgcagtgttttacctggaggggtttatgtctctgagactcagaatcgtgtgataatcttgatgttaaccaatcaaacagtgcacaggttacttttaccacacccctcccggatgtataggagtgtaagttggctaagtgcaatatcttttatttcccaaattactctgggtgtcacaaatgtagtgctggagcgatgtcttttggaattgaaggaaatttggattctcgttatccctcaccaagcatactttgatagctaccgcttaaaatga
Sequence Length
573
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,554 Da
NCBI Official Full Name
Homo sapiens nucleoporin 160kDa, mRNA
NCBI Official Synonym Full Names
nucleoporin 160
NCBI Official Symbol
NUP160
NCBI Protein Information
nuclear pore complex protein Nup160
UniProt Protein Name
Nuclear pore complex protein Nup160
UniProt Gene Name
NUP160
UniProt Synonym Gene Names
KIAA0197; NUP120
UniProt Entry Name
NU160_HUMAN

NCBI Description

NUP160 is 1 of up to 60 proteins that make up the 120-MD nuclear pore complex, which mediates nucleoplasmic transport.[supplied by OMIM, Apr 2004]

Uniprot Description

NUP160: Involved in poly(A)+ RNA transport. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Nucleoporin

Chromosomal Location of Human Ortholog: 11p11.2

Cellular Component: cytosol; kinetochore; nuclear envelope; nuclear pore

Molecular Function: nucleocytoplasmic transporter activity; protein binding

Biological Process: mitotic nuclear envelope disassembly; mRNA export from nucleus; protein sumoylation; RNA-mediated gene silencing; sister chromatid cohesion; tRNA export from nucleus; viral reproduction; viral transcription

Research Articles on NUP160

Similar Products

Product Notes

The NUP160 nup160 (Catalog #AAA1278664) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg cgggagccct ggaacggagc ttcgtggagc taagcggagc tgagcgcgaa aggccgaggc actttcggga attcacagtc tgcagcattg ggactgcaaa tgccgtggct ggcgccgtaa aatacagtga aagcgcggga ggcttttact acgtggagag tggcaagttg ttctccgtaa ccagaaacag gttcattcat tggaagacct ctggagatac attggagctg atggaggagt cactggacat aaatctgttg aataatgcca ttcgcctaaa attccaaaat tgcagtgttt tacctggagg ggtttatgtc tctgagactc agaatcgtgt gataatcttg atgttaacca atcaaacagt gcacaggtta cttttaccac acccctcccg gatgtatagg agtgtaagtt ggctaagtgc aatatctttt atttcccaaa ttactctggg tgtcacaaat gtagtgctgg agcgatgtct tttggaattg aaggaaattt ggattctcgt tatccctcac caagcatact ttgatagcta ccgcttaaaa tga. It is sometimes possible for the material contained within the vial of "NUP160, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.