Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NUDT3 cdna clone

NUDT3 cDNA Clone

Gene Names
NUDT3; DIPP; DIPP1; DIPP-1
Synonyms
NUDT3; NUDT3 cDNA Clone; NUDT3 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgaagctcaagtcgaaccagacccgcacctacgacggcgacggctacaagaagcgggccgcatgcctgtgtttccgcagcgagagcgaggaggaggtgctactcgtgagcagtagtcgccatccagacagatggattgtccctggaggaggcatggagcccgaggaggagccaagtgtggcagcagttcgtgaagtctgtgaggaggctggagtaaaagggacattgggaagattagttggaatttttgagaaccaggagaggaagcacaggacgtatgtctatgtgctcattgtcactgaagtgctggaagactgggaagattcagttaacattggaaggaagagggaatggtttaaaatagaagacgccataaaagtgctgcagtatcacaaacccgtgcaggcatcatattttgaaacattgaggcaaggctactcagccaacaatggcaccccagtcgtggccaccacatactcggtttctgctcagagctcgatgtcaggcatcagatga
Sequence Length
519
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,471 Da
NCBI Official Full Name
Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 3, mRNA
NCBI Official Synonym Full Names
nudix hydrolase 3
NCBI Official Symbol
NUDT3
NCBI Official Synonym Symbols
DIPP; DIPP1; DIPP-1
NCBI Protein Information
diphosphoinositol polyphosphate phosphohydrolase 1
UniProt Protein Name
Diphosphoinositol polyphosphate phosphohydrolase 1
UniProt Gene Name
NUDT3
UniProt Synonym Gene Names
DIPP; DIPP1; DIPP-1; Nudix motif 3
UniProt Entry Name
NUDT3_HUMAN

NCBI Description

NUDT3 belongs to the MutT, or Nudix, protein family. Nudix proteins act as homeostatic checkpoints at important stages in nucleoside phosphate metabolic pathways, guarding against elevated levels of potentially dangerous intermediates, like 8-oxo-dGTP, which promotes AT-to-CG transversions (Safrany et al., 1998 [PubMed 9822604]).[supplied by OMIM, Feb 2011]

Uniprot Description

NUDT3: Cleaves a beta-phosphate from the diphosphate groups in PP-InsP5 (diphosphoinositol pentakisphosphate) and [PP]2-InsP4 (bisdiphosphoinositol tetrakisphosphate), suggesting that it may play a role in signal transduction. InsP6 (inositol hexakisphophate) is not a substrate. Acts as a negative regulator of the ERK1/2 pathway. Also able to catalyze the hydrolysis of dinucleoside oligophosphates, with Ap6A and Ap5A being the preferred substrates. The major reaction products are ADP and p4a from Ap6A and ADP and ATP from Ap5A. Also able to hydrolyze 5- phosphoribose 1-diphosphate. Belongs to the Nudix hydrolase family. DIPP subfamily.

Protein type: Hydrolase; EC 3.6.1.52

Chromosomal Location of Human Ortholog: 6p21.2

Cellular Component: cytosol

Molecular Function: diphosphoinositol-polyphosphate diphosphatase activity; magnesium ion binding

Biological Process: cell-cell signaling; diadenosine polyphosphate catabolic process; inositol phosphate metabolic process

Research Articles on NUDT3

Similar Products

Product Notes

The NUDT3 nudt3 (Catalog #AAA1277462) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgaagc tcaagtcgaa ccagacccgc acctacgacg gcgacggcta caagaagcgg gccgcatgcc tgtgtttccg cagcgagagc gaggaggagg tgctactcgt gagcagtagt cgccatccag acagatggat tgtccctgga ggaggcatgg agcccgagga ggagccaagt gtggcagcag ttcgtgaagt ctgtgaggag gctggagtaa aagggacatt gggaagatta gttggaattt ttgagaacca ggagaggaag cacaggacgt atgtctatgt gctcattgtc actgaagtgc tggaagactg ggaagattca gttaacattg gaaggaagag ggaatggttt aaaatagaag acgccataaa agtgctgcag tatcacaaac ccgtgcaggc atcatatttt gaaacattga ggcaaggcta ctcagccaac aatggcaccc cagtcgtggc caccacatac tcggtttctg ctcagagctc gatgtcaggc atcagatga. It is sometimes possible for the material contained within the vial of "NUDT3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.