NUDCD3 cdna clone
NUDCD3 cDNA Clone
Gene Names
NUDCD3; NudCL
Synonyms
NUDCD3; NUDCD3 cDNA Clone; NUDCD3 cdna clone
Sequence
atggagccaggggcggccgagctgtatgaccaggcccttttgggcatcctgcagcacgtgggcaacgtccaggatttcctgcgcgttctctttggcttcctctaccgcaagacagacttctatcgcttgctgcgccacccatcggaccgcatgggcttcccgcccggggccgcgcaggccttggtgctgcaggtattcaaaacctttgaccacatggcccgtcaggatgatgagaagagaaggcaggaacttgaagagaaaatcagaagaaaggaagaggaagaggccaagactgtgtcagctgctgcagctgagaaggagccagtcccagttccagtccaggaaatagagattgactccaccacagaattggatgggcatcaggaagtagagaaagtgcagcctccaggccctgtgaaggaaatggcccatggttcacaggaggcagaagctccaggagcagttgctggtgctgctgaagtccctagggaaccaccaattcttcccaggattcaggagcagttccagaaaaatcccgacagttacaatggtgctgtccgagagaactacacctggtcacaggactatactgacctggaggtcagggtgccattacccaagcacgtggtgaagggaaagcaggtctcagtggcccttagcagcagctccattcgtgtggccatgctggaggaaaatggggagtgcgtcctcatggaagggaagctcacccacaagatcaacactgagagttctctctggagtctcgagcccgggaagtgcgttttggtgaacctgagcaaggtgggcgagtattggtggaacgccatcctggagggagaagagcccatcgacattgacaagatcaacaaggagcgctccatggccaccgtggatgaggaggaacaggcggtgttggacaggcttacctttgactaccaccagaagctgcagggcaagccacagagccatgagctgaaagtccatgagatgctgaagaaggggtgggatgctgaaggttctcccttccgaggccagcgattcgaccctgccatgttcaacatctccccgggggctgtgcagttttaa
Sequence Length
1086
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
40,822 Da
NCBI Official Full Name
Homo sapiens NudC domain containing 3, mRNA
NCBI Official Synonym Full Names
NudC domain containing 3
NCBI Official Symbol
NUDCD3
NCBI Official Synonym Symbols
NudCL
NCBI Protein Information
nudC domain-containing protein 3
UniProt Protein Name
NudC domain-containing protein 3
Protein Family
UniProt Gene Name
NUDCD3
UniProt Synonym Gene Names
KIAA1068
UniProt Entry Name
NUDC3_HUMAN
NCBI Description
The product of this gene functions to maintain the stability of dynein intermediate chain. Depletion of this gene product results in aggregation and degradation of dynein intermediate chain, mislocalization of the dynein complex from kinetochores, spindle microtubules, and spindle poles, and loss of gamma-tubulin from spindle poles. The protein localizes to the Golgi apparatus during interphase, and levels of the protein increase after the G1/S transition. [provided by RefSeq, Jul 2008]
Uniprot Description
NUDCD3:
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 7p13-p12
Molecular Function: protein binding
Research Articles on NUDCD3
Similar Products
Product Notes
The NUDCD3 nudcd3 (Catalog #AAA1278997) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagccag gggcggccga gctgtatgac caggcccttt tgggcatcct gcagcacgtg ggcaacgtcc aggatttcct gcgcgttctc tttggcttcc tctaccgcaa gacagacttc tatcgcttgc tgcgccaccc atcggaccgc atgggcttcc cgcccggggc cgcgcaggcc ttggtgctgc aggtattcaa aacctttgac cacatggccc gtcaggatga tgagaagaga aggcaggaac ttgaagagaa aatcagaaga aaggaagagg aagaggccaa gactgtgtca gctgctgcag ctgagaagga gccagtccca gttccagtcc aggaaataga gattgactcc accacagaat tggatgggca tcaggaagta gagaaagtgc agcctccagg ccctgtgaag gaaatggccc atggttcaca ggaggcagaa gctccaggag cagttgctgg tgctgctgaa gtccctaggg aaccaccaat tcttcccagg attcaggagc agttccagaa aaatcccgac agttacaatg gtgctgtccg agagaactac acctggtcac aggactatac tgacctggag gtcagggtgc cattacccaa gcacgtggtg aagggaaagc aggtctcagt ggcccttagc agcagctcca ttcgtgtggc catgctggag gaaaatgggg agtgcgtcct catggaaggg aagctcaccc acaagatcaa cactgagagt tctctctgga gtctcgagcc cgggaagtgc gttttggtga acctgagcaa ggtgggcgag tattggtgga acgccatcct ggagggagaa gagcccatcg acattgacaa gatcaacaag gagcgctcca tggccaccgt ggatgaggag gaacaggcgg tgttggacag gcttaccttt gactaccacc agaagctgca gggcaagcca cagagccatg agctgaaagt ccatgagatg ctgaagaagg ggtgggatgc tgaaggttct cccttccgag gccagcgatt cgaccctgcc atgttcaaca tctccccggg ggctgtgcag ttttaa. It is sometimes possible for the material contained within the vial of "NUDCD3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
