NTNG1 cdna clone
NTNG1 cDNA Clone
Gene Names
NTNG1; Lmnt1
Synonyms
NTNG1; NTNG1 cDNA Clone; NTNG1 cdna clone
Sequence
atgtatttgtcaagattcctgtcgattcatgccctttgggttacggtgtcctcagtgatgcagccctaccctttggtttggggacattatgatttgtgtaagactcagatttacacggaagaagggaaagtttgggattacatggcctgccagccggaatccacggacatgacaaaatatctgaaagtgaaactcgatcctccggatattacctgtggagaccctcctgagacgttctgtgcaatgggcaatccctacatgtgcaataatgagtgtgatgcgagtacccctgagctggcacacccccctgagctgatgtttgattttgaaggaagacatccctccacattttggcagtctgccacttggaaggagtatcccaagcctctccaggttaacatcactctgtcttggagcaaaaccattgagctaacagacaacatagttattacctttgaatctgggcgtccagaccaaatgatcctggagaagtctctcgattatggacgaacatggcagccctatcagtattatgccacagactgcttagatgcttttcacatggatcctaaatccgtgaaggatttatcacagcatacggtcttagaaatcatttgcacagaagagtactcaacagggtatacaacaaatagcaaaataatccactttgaaatcaaagacaggttcgcgttttttgctggacctcgcctacgcaatatggcttccctctacggacagctggatacaaccaagaaactcagagatttctttacagtcacagacctgaggataaggctgttaagaccagccgttggggaaatatttgtagatgagctacacttggcacgctacttttacgcgatctcagacataaaggtgcgaggaaggtgcaagtgtaatctccatgccactgtatgtgtgtatgacaacagcaaattgacatgcgaatgtgagcacaacactacaggtccagactgtgggaaatgcaagaagaattatcagggccgaccttggagtccaggctcctatctccccatccccaaaggcactgcaaatacctgtatccccagtatttccagtattggtacgaatgtctgcgacaacgagctcctgcactgccagaacggagggacgtgccacaacaacgtgcgctgcctgtgcccggccgcatacacgggcatcctctgcgagaagctgcggtgcgaggaggctggcagctgcggctccgactctggccagggcgcgcccccgcacggctccccagcgctgctgctgctgaccacgctgctgggaaccgccagccccctggtgttctag
Sequence Length
1317
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
55,660 Da
NCBI Official Full Name
Homo sapiens netrin G1, mRNA
NCBI Official Synonym Full Names
netrin G1
NCBI Official Symbol
NTNG1
NCBI Official Synonym Symbols
Lmnt1
NCBI Protein Information
netrin-G1
UniProt Protein Name
Netrin-G1
Protein Family
UniProt Gene Name
NTNG1
UniProt Synonym Gene Names
KIAA0976; LMNT1
UniProt Entry Name
NTNG1_HUMAN
NCBI Description
This gene encodes a preproprotein that is processed into a secreted protein containing eukaroytic growth factor (EGF)-like domains. This protein acts to guide axon growth during neuronal development. Polymorphisms in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2015]
Uniprot Description
NTNG1: Promotes neurite outgrowth of both axons and dendrites. 6 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, GPI anchor
Chromosomal Location of Human Ortholog: 1p13.3
Cellular Component: anchored to plasma membrane
Molecular Function: protein binding
Biological Process: axonogenesis
Research Articles on NTNG1
Similar Products
Product Notes
The NTNG1 ntng1 (Catalog #AAA1277271) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtatttgt caagattcct gtcgattcat gccctttggg ttacggtgtc ctcagtgatg cagccctacc ctttggtttg gggacattat gatttgtgta agactcagat ttacacggaa gaagggaaag tttgggatta catggcctgc cagccggaat ccacggacat gacaaaatat ctgaaagtga aactcgatcc tccggatatt acctgtggag accctcctga gacgttctgt gcaatgggca atccctacat gtgcaataat gagtgtgatg cgagtacccc tgagctggca cacccccctg agctgatgtt tgattttgaa ggaagacatc cctccacatt ttggcagtct gccacttgga aggagtatcc caagcctctc caggttaaca tcactctgtc ttggagcaaa accattgagc taacagacaa catagttatt acctttgaat ctgggcgtcc agaccaaatg atcctggaga agtctctcga ttatggacga acatggcagc cctatcagta ttatgccaca gactgcttag atgcttttca catggatcct aaatccgtga aggatttatc acagcatacg gtcttagaaa tcatttgcac agaagagtac tcaacagggt atacaacaaa tagcaaaata atccactttg aaatcaaaga caggttcgcg ttttttgctg gacctcgcct acgcaatatg gcttccctct acggacagct ggatacaacc aagaaactca gagatttctt tacagtcaca gacctgagga taaggctgtt aagaccagcc gttggggaaa tatttgtaga tgagctacac ttggcacgct acttttacgc gatctcagac ataaaggtgc gaggaaggtg caagtgtaat ctccatgcca ctgtatgtgt gtatgacaac agcaaattga catgcgaatg tgagcacaac actacaggtc cagactgtgg gaaatgcaag aagaattatc agggccgacc ttggagtcca ggctcctatc tccccatccc caaaggcact gcaaatacct gtatccccag tatttccagt attggtacga atgtctgcga caacgagctc ctgcactgcc agaacggagg gacgtgccac aacaacgtgc gctgcctgtg cccggccgca tacacgggca tcctctgcga gaagctgcgg tgcgaggagg ctggcagctg cggctccgac tctggccagg gcgcgccccc gcacggctcc ccagcgctgc tgctgctgac cacgctgctg ggaaccgcca gccccctggt gttctag. It is sometimes possible for the material contained within the vial of "NTNG1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
