Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NSMCE2 cdna clone

NSMCE2 cDNA Clone

Gene Names
NSMCE2; NSE2; MMS21; ZMIZ7; C8orf36
Synonyms
NSMCE2; NSMCE2 cDNA Clone; NSMCE2 cdna clone
Ordering
For Research Use Only!
Sequence
atgccaggacgttccagttcaaattcaggttcaactggtttcatctccttcagtggtgtagagtctgctctctcctccttgaaaaacttccaagcctgtatcaactctggtatggacacagcttctagtgttgctttggatcttgtggaaagtcagactgaagtgagtagtgaatatagtatggacaaggcaatggttgaatttgctacattggatcggcaactaaaccattatgtaaaggctgttcaatctacaataaatcatgtgaaagaagaacgtccagaaaaaataccagatttaaaattattggtagagaagaaatttttggctttacagagcaagaattctgatgcagactttcaaaataatgaaaaatttgtacagtttaaacaacagctgaaagaactaaagaagcaatgtggtcttcaagctgacagagaagctgacggaacagaaggagtggatgaagatataattgtgacccaaagtcagaccaacttcacctgccccattacaaaggaggaaatgaagaagccagtgaaaaataaagtgtgtggccacacctatgaagaggacgccattgttcgcatgattgagtccaggcaaaagcggaagaaaaaggcctattgccctcaaattggctgtagccacacggatataagaaagtcagatcttatccaggatgaagcacttagaagggcaattgagaaccataacaagaaaagacatcgtcattccgagtag
Sequence Length
744
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,932 Da
NCBI Official Full Name
Homo sapiens non-SMC element 2, MMS21 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
NSE2/MMS21 homolog, SMC5-SMC6 complex SUMO ligase
NCBI Official Symbol
NSMCE2
NCBI Official Synonym Symbols
NSE2; MMS21; ZMIZ7; C8orf36
NCBI Protein Information
E3 SUMO-protein ligase NSE2
UniProt Protein Name
E3 SUMO-protein ligase NSE2
Protein Family
UniProt Gene Name
NSMCE2
UniProt Synonym Gene Names
C8orf36; MMS21; hMMS21; Non-SMC element 2 homolog
UniProt Entry Name
NSE2_HUMAN

Uniprot Description

NSMCE2: E3 SUMO-protein ligase component of the SMC5-SMC6 complex, a complex involved in DNA double-strand break repair by homologous recombination. Is not be required for the stability of the complex. The complex may promote sister chromatid homologous recombination by recruiting the SMC1-SMC3 cohesin complex to double-strand breaks. The complex is required for telomere maintenance via recombination in ALT (alternative lengthening of telomeres) cell lines and mediates sumoylation of shelterin complex (telosome) components which is proposed to lead to shelterin complex disassembly in ALT-associated PML bodies (APBs). Acts as a E3 ligase mediating SUMO attachment to various proteins such as SMC6L1 and TRAX, the shelterin complex subunits TERF1, TERF2, TINF2 and TERF2IP, and maybe the cohesin components RAD21 and STAG2. Required for recruitment of telomeres to PML nuclear bodies. SUMO protein-ligase activity is required for the prevention of DNA damage-induced apoptosis by facilitating DNA repair, and for formation of APBs in ALT cell lines. Required for sister chromatid cohesion during prometaphase and mitotic progression. Belongs to the NSE2 family.

Protein type: SUMO conjugating system; Ubiquitin ligase; EC 6.3.2.-; Ligase; EC 6.-.-.-

Chromosomal Location of Human Ortholog: 8q24.13

Cellular Component: chromosome, telomeric region; nucleoplasm; nucleus; PML body

Molecular Function: protein binding; SUMO ligase activity

Biological Process: double-strand break repair via homologous recombination; double-strand break repair via nonhomologous end joining; positive regulation of maintenance of mitotic sister chromatid cohesion; positive regulation of mitotic metaphase/anaphase transition; protein sumoylation; telomere maintenance via recombination

Research Articles on NSMCE2

Similar Products

Product Notes

The NSMCE2 nsmce2 (Catalog #AAA1270432) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccaggac gttccagttc aaattcaggt tcaactggtt tcatctcctt cagtggtgta gagtctgctc tctcctcctt gaaaaacttc caagcctgta tcaactctgg tatggacaca gcttctagtg ttgctttgga tcttgtggaa agtcagactg aagtgagtag tgaatatagt atggacaagg caatggttga atttgctaca ttggatcggc aactaaacca ttatgtaaag gctgttcaat ctacaataaa tcatgtgaaa gaagaacgtc cagaaaaaat accagattta aaattattgg tagagaagaa atttttggct ttacagagca agaattctga tgcagacttt caaaataatg aaaaatttgt acagtttaaa caacagctga aagaactaaa gaagcaatgt ggtcttcaag ctgacagaga agctgacgga acagaaggag tggatgaaga tataattgtg acccaaagtc agaccaactt cacctgcccc attacaaagg aggaaatgaa gaagccagtg aaaaataaag tgtgtggcca cacctatgaa gaggacgcca ttgttcgcat gattgagtcc aggcaaaagc ggaagaaaaa ggcctattgc cctcaaattg gctgtagcca cacggatata agaaagtcag atcttatcca ggatgaagca cttagaaggg caattgagaa ccataacaag aaaagacatc gtcattccga gtag. It is sometimes possible for the material contained within the vial of "NSMCE2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.