Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NR1D2 cdna clone

NR1D2 cDNA Clone

Gene Names
NR1D2; RVR; BD73; EAR-1R
Synonyms
NR1D2; NR1D2 cDNA Clone; NR1D2 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggtgaatgcaggaggtgtgattgcctatatcagttcttccagctcagcctcaagccctgcctcttgtcacagtgagggttctgagaatagtttccagtcctcctcctcttctgttccatcttctccaaatagctctaattctgataccaatggtaatcccaagaatggtgatctcgccaatattgaaggcatcttgaagaatgatcgaatagattgttctatgaaaacaagcaaatcgagtgcacctgggatgacaaaaagtcatagtggtgtgacaaaatttagtggcatggttctactgtgtaaagtctgtggggatgtggcgtcaggattccactatggagttcatgcttgcgaaggctgtaagggtttctttcggagaagtattcaacaaaacatccagtacaagaagtgcctgaagaatgaaaactgttctataatgagaatgaataggaacagatgtcagcaatgtcgcttcaaaaagtgtctgtctgttggaatgtcaagagatgctgttcggtttggtcgtattcctaagcgtgaaaaacagaggatgctaattgaaatgcaaagtgcaatgaagaccatgatgaacagccagttcagtggtcacttgcaaaatgacacattagtagaacatcatgaacagacagccttgccagcccaggaacagctgcgacccaagccccaactggagcaagaaaacatcaaaagctcttctcctccatcttctgattttgcaaaggaagaagtgattggcatggtgaccagagctcacaaggatacctttatgtataatcaagagcagcaagaaaactcagctgagagcatgcagccccagagaggagaacggattcccaagaacatggagcaatataatttaaatcatgatcattgcggcaatgggcttagcagccattttccctgtagtgagagccagcagcatctcaatggacagttcaaagggaggaatataatgcattacccaaatggtcatgccatttgtattgcaaatggacattgtatgaacttctccaatgcttatactcaaagagtatgtgatagagttccgatagatggattttctcagaatgagaacaagaatagttacctgtgcaacactggaggaagaatgcatctgtacagtgttcatattcagccaaaatttcaccaaaaacagcagtaccacaccatttccagtttaaaccatgaagtcctttga
Sequence Length
1227
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
64,625 Da
NCBI Official Full Name
Homo sapiens nuclear receptor subfamily 1, group D, member 2, mRNA
NCBI Official Synonym Full Names
nuclear receptor subfamily 1 group D member 2
NCBI Official Symbol
NR1D2
NCBI Official Synonym Symbols
RVR; BD73; EAR-1R
NCBI Protein Information
nuclear receptor subfamily 1 group D member 2
UniProt Protein Name
Nuclear receptor subfamily 1 group D member 2
UniProt Gene Name
NR1D2
UniProt Synonym Gene Names
RVR; EAR-1R
UniProt Entry Name
NR1D2_HUMAN

NCBI Description

This gene encodes a member of the nuclear hormone receptor family, specifically the NR1 subfamily of receptors. The encoded protein functions as a transcriptional repressor and may play a role in circadian rhythms and carbohydrate and lipid metabolism. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]

Uniprot Description

NR1D2: Binds to the sequences 5'-AATGTAGGTCA-3' and 5'- ATAACTAGGTCA-3'. Acts as a potent competitive repressor of ROR alpha function. Belongs to the nuclear hormone receptor family. NR1 subfamily.

Protein type: Nuclear receptor; DNA-binding

Chromosomal Location of Human Ortholog: 3p24.2

Cellular Component: nucleoplasm; nucleus

Molecular Function: ligand-dependent nuclear receptor activity; protein binding

Biological Process: lipid homeostasis; negative regulation of transcription, DNA-dependent; positive regulation of transcription, DNA-dependent; regulation of circadian rhythm; regulation of inflammatory response; regulation of lipid metabolic process; regulation of transcription, DNA-dependent; transcription initiation from RNA polymerase II promoter

Research Articles on NR1D2

Similar Products

Product Notes

The NR1D2 nr1d2 (Catalog #AAA1271942) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggtga atgcaggagg tgtgattgcc tatatcagtt cttccagctc agcctcaagc cctgcctctt gtcacagtga gggttctgag aatagtttcc agtcctcctc ctcttctgtt ccatcttctc caaatagctc taattctgat accaatggta atcccaagaa tggtgatctc gccaatattg aaggcatctt gaagaatgat cgaatagatt gttctatgaa aacaagcaaa tcgagtgcac ctgggatgac aaaaagtcat agtggtgtga caaaatttag tggcatggtt ctactgtgta aagtctgtgg ggatgtggcg tcaggattcc actatggagt tcatgcttgc gaaggctgta agggtttctt tcggagaagt attcaacaaa acatccagta caagaagtgc ctgaagaatg aaaactgttc tataatgaga atgaatagga acagatgtca gcaatgtcgc ttcaaaaagt gtctgtctgt tggaatgtca agagatgctg ttcggtttgg tcgtattcct aagcgtgaaa aacagaggat gctaattgaa atgcaaagtg caatgaagac catgatgaac agccagttca gtggtcactt gcaaaatgac acattagtag aacatcatga acagacagcc ttgccagccc aggaacagct gcgacccaag ccccaactgg agcaagaaaa catcaaaagc tcttctcctc catcttctga ttttgcaaag gaagaagtga ttggcatggt gaccagagct cacaaggata cctttatgta taatcaagag cagcaagaaa actcagctga gagcatgcag ccccagagag gagaacggat tcccaagaac atggagcaat ataatttaaa tcatgatcat tgcggcaatg ggcttagcag ccattttccc tgtagtgaga gccagcagca tctcaatgga cagttcaaag ggaggaatat aatgcattac ccaaatggtc atgccatttg tattgcaaat ggacattgta tgaacttctc caatgcttat actcaaagag tatgtgatag agttccgata gatggatttt ctcagaatga gaacaagaat agttacctgt gcaacactgg aggaagaatg catctgtaca gtgttcatat tcagccaaaa tttcaccaaa aacagcagta ccacaccatt tccagtttaa accatgaagt cctttga. It is sometimes possible for the material contained within the vial of "NR1D2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.