Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NPM1 cdna clone

NPM1 cDNA Clone

Gene Names
NPM1; B23; NPM
Synonyms
NPM1; NPM1 cDNA Clone; NPM1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaagattcgatggacatggacatgagccccctgaggccccagaactatcttttcggttgtgaactaaaggccgacaaagattatcactttaaggtggataatgatgaaaatgagcaccagttatctttaagaacggtcagtttaggggctggtgcaaaggatgagttgcacattgttgaagcagaggcaatgaattacgaaggcagtccaattaaagtaacactggcaactttgaaaatgtctgtacagccaacggtttcccttgggggctttgaaataacaccaccagtggtcttaaggttgaagtgtggttcagggccagtgcatattagtggacagcacttagtagctgtggaggaagatgcagagtcagaagatgaagaggaggaggatgtgaaactcttaagtatatctggaaagcggtctgcccctggaggtggtagcaaggttccacagaaaaaagtaaaacttgctgctgatgaagatgatgacgatgatgatgaagaggatgatgatgaagatgatgatgatgatgattttgatgatgaggaagctgaagaaaaagcgccagtgaagaaatctatacgagatactccagccaaaaatgcacaaaagtcaaatcagaatggaaaagactcaaaaccatcatcaacaccaagatcaaaaggacaagaatccttcaagaaacaggaaaaaactcctaaaacaccaaaaggacctagttctgtagaagacattaaagcaaaaatgcaagcaagtatagaaaaaggtggttctcttcccaaagtggaagccaaattcatcaattatgtgaagaattgcttccggatgactgaccaagaggctattcaagatttctggcagtggaggaagtctctttaa
Sequence Length
885
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,400 Da
NCBI Official Full Name
Homo sapiens nucleophosmin (nucleolar phosphoprotein B23, numatrin), mRNA
NCBI Official Synonym Full Names
nucleophosmin
NCBI Official Symbol
NPM1
NCBI Official Synonym Symbols
B23; NPM
NCBI Protein Information
nucleophosmin
UniProt Protein Name
Nucleophosmin
Protein Family
UniProt Gene Name
NPM1
UniProt Synonym Gene Names
NPM; NPM
UniProt Entry Name
NPM_HUMAN

NCBI Description

This gene encodes a phosphoprotein which moves between the nucleus and the cytoplasm. The gene product is thought to be involved in several processes including regulation of the ARF/p53 pathway. A number of genes are fusion partners have been characterized, in particular the anaplastic lymphoma kinase gene on chromosome 2. Mutations in this gene are associated with acute myeloid leukemia. More than a dozen pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]

Uniprot Description

NPM1: a nucleolar protein associated with nucleolar ribonucleoprotein structures and that binds single-stranded nucleic acids. Is a major component of template activating factor (TAF)-III. It plays a role in controlling centrosome duplication, and may function in the assembly and/or transport of the ribosome. Two alternatively spliced isoforms have been described.

Protein type: Oncoprotein; RNA-binding; Nucleolus; Translation

Chromosomal Location of Human Ortholog: 5q35.1

Cellular Component: centrosome; cytoplasm; cytosol; focal adhesion; membrane; nucleolus; nucleoplasm; nucleus; ribonucleoprotein complex; spindle pole centrosome

Molecular Function: histone binding; NF-kappaB binding; protein binding; protein heterodimerization activity; protein homodimerization activity; protein kinase binding; protein kinase inhibitor activity; ribosomal large subunit binding; ribosomal small subunit binding; RNA binding; Tat protein binding; transcription coactivator activity; unfolded protein binding

Biological Process: activation of NF-kappaB transcription factor; cell aging; centrosome cycle; DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest; DNA repair; DNA replication-independent nucleosome assembly at centromere; intracellular protein transport; negative regulation of apoptosis; negative regulation of cell proliferation; nucleocytoplasmic transport; nucleosome assembly; positive regulation of cell proliferation; positive regulation of transcription, DNA-dependent; positive regulation of translation; protein localization; protein oligomerization; regulation of centriole replication; regulation of endodeoxyribonuclease activity; response to stress; ribosome assembly

Research Articles on NPM1

Similar Products

Product Notes

The NPM1 npm1 (Catalog #AAA1274262) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagatt cgatggacat ggacatgagc cccctgaggc cccagaacta tcttttcggt tgtgaactaa aggccgacaa agattatcac tttaaggtgg ataatgatga aaatgagcac cagttatctt taagaacggt cagtttaggg gctggtgcaa aggatgagtt gcacattgtt gaagcagagg caatgaatta cgaaggcagt ccaattaaag taacactggc aactttgaaa atgtctgtac agccaacggt ttcccttggg ggctttgaaa taacaccacc agtggtctta aggttgaagt gtggttcagg gccagtgcat attagtggac agcacttagt agctgtggag gaagatgcag agtcagaaga tgaagaggag gaggatgtga aactcttaag tatatctgga aagcggtctg cccctggagg tggtagcaag gttccacaga aaaaagtaaa acttgctgct gatgaagatg atgacgatga tgatgaagag gatgatgatg aagatgatga tgatgatgat tttgatgatg aggaagctga agaaaaagcg ccagtgaaga aatctatacg agatactcca gccaaaaatg cacaaaagtc aaatcagaat ggaaaagact caaaaccatc atcaacacca agatcaaaag gacaagaatc cttcaagaaa caggaaaaaa ctcctaaaac accaaaagga cctagttctg tagaagacat taaagcaaaa atgcaagcaa gtatagaaaa aggtggttct cttcccaaag tggaagccaa attcatcaat tatgtgaaga attgcttccg gatgactgac caagaggcta ttcaagattt ctggcagtgg aggaagtctc tttaa. It is sometimes possible for the material contained within the vial of "NPM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.