Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NPFFR2 cdna clone

NPFFR2 cDNA Clone

Gene Names
NPFFR2; GPR74; NPFF2; NPGPR; HLWAR77
Synonyms
NPFFR2; NPFFR2 cDNA Clone; NPFFR2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaatgagaaatgggacacaaactcttcagaaaactggcatcccatctggaatgtcaatgacacaaagcatcatctgtactcagatattaatattacctatgtgaactactatcttcaccagcctcaagtggcagcaatcttcattatttcctactttctgatcttctttttgtgcatgatgggaaatactgtggtttgctttattgtaatgaggaacaaacatatgcacacagtcactaatctcttcatcttaaacctggccataagtgatttactagttggcatattctgcatgcctataacactgctggacaatattatagcaggatggccatttggaaacacgatgtgcaagatcagtggattggtccagggaatatctgtcgcagcttcagtctttacgttagttgcaattgctgtagataggttccagtgtgtggtctacccttttaaaccaaagctcactatcaagacagcgtttgtcattattatgatcatctgggtcctagccatcaccattatgtctccatctgcagtaatgttacatgtgcaagaagaaaaatattaccgagtgagactcaactcccagaataaaaccagtccagtctactggtgccgggaagactggccaaatcaggaaatgaggaagatctacaccactgtgctgtttgccaacatctacctggctcccctctccctcattgtcatcatgtatggaaggattggaatttcactcttcagggctgcagttcctcacacaggcaggaagaaccaggagcagtggcacgtggtgtccaggaagaagcagaagatcattaagatgctcctgattgtggccctgctttttattctctcatggctgcccctgtggactctaatgatgctctcagactacgctgacctttctccaaatgaactgcagatcatcaacatctacatctacccttttgcacactggctggcattcggcaacagcagtgtcaatcccatcatttatggtttcttcaacgagaatttccgccgtggtttccaagaagctttccagctccagctctgccaaaaaagagcaaagcctatggaagcttatgccctaaaagctaaaagccatgtgctcataaacacatctaatcagcttgtccaggaatctacatttcaaaaccctcatggggaaaccttgctttataggaaaagtgctgaaaaaccccaacaggaattagtgatggaagaattaaaagaaactactaacagcagtgagatttaa
Sequence Length
1263
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,055 Da
NCBI Official Full Name
Homo sapiens neuropeptide FF receptor 2, mRNA
NCBI Official Synonym Full Names
neuropeptide FF receptor 2
NCBI Official Symbol
NPFFR2
NCBI Official Synonym Symbols
GPR74; NPFF2; NPGPR; HLWAR77
NCBI Protein Information
neuropeptide FF receptor 2
UniProt Protein Name
Neuropeptide FF receptor 2
Protein Family
UniProt Gene Name
NPFFR2
UniProt Synonym Gene Names
GPR74; NPFF2; NPGPR
UniProt Entry Name
NPFF2_HUMAN

NCBI Description

This gene encodes a member of a subfamily of G-protein-coupled neuropeptide receptors. This protein is activated by the neuropeptides A-18-amide (NPAF) and F-8-amide (NPFF) and may function in pain modulation and regulation of the opioid system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]

Uniprot Description

NPFFR2: Receptor for NPAF (A-18-F-amide) and NPFF (F-8-F-amide) neuropeptides, also known as morphine-modulating peptides. Can also be activated by a variety of naturally occurring or synthetic FMRF-amide like ligands. This receptor mediates its action by association with G proteins that activate a phosphatidylinositol- calcium second messenger system. Belongs to the G-protein coupled receptor 1 family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Membrane protein, integral; GPCR, family 1; Receptor, GPCR

Chromosomal Location of Human Ortholog: 4q21

Cellular Component: actin cytoskeleton; integral to plasma membrane; plasma membrane

Molecular Function: G-protein coupled receptor activity; neuropeptide receptor activity; peptide binding

Biological Process: cellular response to hormone stimulus; detection of abiotic stimulus; G-protein coupled receptor protein signaling pathway; synaptic transmission

Research Articles on NPFFR2

Similar Products

Product Notes

The NPFFR2 npffr2 (Catalog #AAA1268233) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatgaga aatgggacac aaactcttca gaaaactggc atcccatctg gaatgtcaat gacacaaagc atcatctgta ctcagatatt aatattacct atgtgaacta ctatcttcac cagcctcaag tggcagcaat cttcattatt tcctactttc tgatcttctt tttgtgcatg atgggaaata ctgtggtttg ctttattgta atgaggaaca aacatatgca cacagtcact aatctcttca tcttaaacct ggccataagt gatttactag ttggcatatt ctgcatgcct ataacactgc tggacaatat tatagcagga tggccatttg gaaacacgat gtgcaagatc agtggattgg tccagggaat atctgtcgca gcttcagtct ttacgttagt tgcaattgct gtagataggt tccagtgtgt ggtctaccct tttaaaccaa agctcactat caagacagcg tttgtcatta ttatgatcat ctgggtccta gccatcacca ttatgtctcc atctgcagta atgttacatg tgcaagaaga aaaatattac cgagtgagac tcaactccca gaataaaacc agtccagtct actggtgccg ggaagactgg ccaaatcagg aaatgaggaa gatctacacc actgtgctgt ttgccaacat ctacctggct cccctctccc tcattgtcat catgtatgga aggattggaa tttcactctt cagggctgca gttcctcaca caggcaggaa gaaccaggag cagtggcacg tggtgtccag gaagaagcag aagatcatta agatgctcct gattgtggcc ctgcttttta ttctctcatg gctgcccctg tggactctaa tgatgctctc agactacgct gacctttctc caaatgaact gcagatcatc aacatctaca tctacccttt tgcacactgg ctggcattcg gcaacagcag tgtcaatccc atcatttatg gtttcttcaa cgagaatttc cgccgtggtt tccaagaagc tttccagctc cagctctgcc aaaaaagagc aaagcctatg gaagcttatg ccctaaaagc taaaagccat gtgctcataa acacatctaa tcagcttgtc caggaatcta catttcaaaa ccctcatggg gaaaccttgc tttataggaa aagtgctgaa aaaccccaac aggaattagt gatggaagaa ttaaaagaaa ctactaacag cagtgagatt taa. It is sometimes possible for the material contained within the vial of "NPFFR2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.