Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NOP10 cdna clone

NOP10 cDNA Clone

Gene Names
NOP10; DKCB1; NOLA3; NOP10P
Synonyms
NOP10; NOP10 cDNA Clone; NOP10 cdna clone
Ordering
For Research Use Only!
Sequence
atgtttctccagtattacctcaacgagcagggagatcgagtctatacgctgaagaaatttgacccgatgggacaacagacctgctcagcccatcctgctcggttctccccagatgacaaatactctcgacaccgaatcaccatcaagaaacgcttcaaggtgctcatgacccagcaaccgcgccctgtcctctga
Sequence Length
195
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
7,706 Da
NCBI Official Full Name
Homo sapiens NOP10 ribonucleoprotein homolog (yeast), mRNA
NCBI Official Synonym Full Names
NOP10 ribonucleoprotein
NCBI Official Symbol
NOP10
NCBI Official Synonym Symbols
DKCB1; NOLA3; NOP10P
NCBI Protein Information
H/ACA ribonucleoprotein complex subunit 3
UniProt Protein Name
H/ACA ribonucleoprotein complex subunit 3
UniProt Gene Name
NOP10
UniProt Synonym Gene Names
NOLA3
UniProt Entry Name
NOP10_HUMAN

NCBI Description

This gene is a member of the H/ACA snoRNPs (small nucleolar ribonucleoproteins) gene family. snoRNPs are involved in various aspects of rRNA processing and modification and have been classified into two families: C/D and H/ACA. The H/ACA snoRNPs also include the DKC1, NOLA1 and NOLA2 proteins. These four H/ACA snoRNP proteins localize to the dense fibrillar components of nucleoli and to coiled (Cajal) bodies in the nucleus. Both 18S rRNA production and rRNA pseudouridylation are impaired if any one of the four proteins is depleted. The four H/ACA snoRNP proteins are also components of the telomerase complex. This gene encodes a protein related to Saccharomyces cerevisiae Nop10p. [provided by RefSeq, Jul 2008]

Uniprot Description

NOP10: Required for ribosome biogenesis and telomere maintenance. Part of the H/ACA small nucleolar ribonucleoprotein (H/ACA snoRNP) complex, which catalyzes pseudouridylation of rRNA. This involves the isomerization of uridine such that the ribose is subsequently attached to C5, instead of the normal N1. Each rRNA can contain up to 100 pseudouridine (psi) residues, which may serve to stabilize the conformation of rRNAs. May also be required for correct processing or intranuclear trafficking of TERC, the RNA component of the telomerase reverse transcriptase (TERT) holoenzyme. Defects in NOP10 are a cause of dyskeratosis congenita autosomal recessive type 1 (DKCB1). A rare multisystem disorder caused by defective telomere maintenance. It is characterized by progressive bone marrow failure, and the clinical triad of reticulated skin hyperpigmentation, nail dystrophy, and mucosal leukoplakia. Common but variable features include premature graying, aplastic anemia, low platelets, osteoporosis, pulmonary fibrosis, and liver fibrosis among others. Early mortality is often associated with bone marrow failure, infections, fatal pulmonary complications, or malignancy. Belongs to the NOP10 family.

Protein type: Nucleolus

Chromosomal Location of Human Ortholog: 15q14-q15

Cellular Component: nucleoplasm; nucleus; small nucleolar ribonucleoprotein complex; telomerase holoenzyme complex

Molecular Function: protein binding

Biological Process: rRNA pseudouridine synthesis; telomere maintenance via telomerase

Disease: Dyskeratosis Congenita, Autosomal Recessive, 1

Research Articles on NOP10

Similar Products

Product Notes

The NOP10 nop10 (Catalog #AAA1276709) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttctcc agtattacct caacgagcag ggagatcgag tctatacgct gaagaaattt gacccgatgg gacaacagac ctgctcagcc catcctgctc ggttctcccc agatgacaaa tactctcgac accgaatcac catcaagaaa cgcttcaagg tgctcatgac ccagcaaccg cgccctgtcc tctga. It is sometimes possible for the material contained within the vial of "NOP10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.