Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

NONO cdna clone

NONO cDNA Clone

Gene Names
NONO; P54; NMT55; NRB54; MRXS34; P54NRB; PPP1R114
Synonyms
NONO; NONO cDNA Clone; NONO cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atgccactccgtggaaagcagctgcgtgtgcgctttgcctgccatagtgcatcccttacagttcgaaaccttcctcagtatgtgtccaacgaactgctggaagaagccttttctgtgtttggccaggtagagagggctgtagtcattgtggatgatcgaggaaggccctcaggaaaaggcattgttgagttctcagggaagccagctgctcggaaagctctggacagatgcagtgaaggctccttcctgctaaccacatttcctcgtcctgtgactgtggagcccatggaccagttagatgatgaagagggacttccagagaagctggttataaaaaaccagcaatttcacaaggaacgagagcagccacccagatttgcacagcctggctcctttgagtatgaatatgccatgcgctggaaggcactcattgagatggagaagcagcagcaggaccaagtggaccgcaacatcaaggaggctcgtgagaagctggagatggagatggaagctgcacgccatgagcaccaggtcatgctaatgagacaggatttgatgaggcgccaagaagaacttcggaggatggaagagctgcacaaccaagaggtgcaaaaacgaaagcaactggagctcaggcaggaggaagagcgcaggcgccgtgaagaagagatgcggcggcagcaagaagaaatgatgcggcgacagcaggaaggattcaagggaaccttccctgatgcgagagagcaggagattcggatgggtcagatggctatgggaggtgctatgggcataaacaacagaggtgccatgccccctgctcctgtgccagctggtaccccagctcctccaggacctgccactatgatgccggatggaactttgggattgaccccaccaacaactgaacgctttggtcaggctgctacaatggaaggaattggggcaattggtggaactcctcctgcattcaaccgtgcagctcctggagctgaatttgccccaaacaaacgtcgccgatactaa
Sequence Length
1023
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,866 Da
NCBI Official Full Name
Homo sapiens non-POU domain containing, octamer-binding, mRNA
NCBI Official Synonym Full Names
non-POU domain containing, octamer-binding
NCBI Official Symbol
NONO
NCBI Official Synonym Symbols
P54; NMT55; NRB54; MRXS34; P54NRB; PPP1R114
NCBI Protein Information
non-POU domain-containing octamer-binding protein
UniProt Protein Name
Non-POU domain-containing octamer-binding protein
UniProt Gene Name
NONO
UniProt Synonym Gene Names
NRB54; NonO protein; p54nrb
UniProt Entry Name
NONO_HUMAN

NCBI Description

This gene encodes an RNA-binding protein which plays various roles in the nucleus, including transcriptional regulation and RNA splicing. A rearrangement between this gene and the transcription factor E3 gene has been observed in papillary renal cell carcinoma. Alternatively spliced transcript variants have been described. Pseudogenes exist on Chromosomes 2 and 16. [provided by RefSeq, Feb 2009]

Uniprot Description

NONO: DNA- and RNA binding protein, involved in several nuclear processes. Binds the conventional octamer sequence in double stranded DNA. Also binds single-stranded DNA and RNA at a site independent of the duplex site. Involved in pre-mRNA splicing, probably as a heterodimer with SFPQ. Interacts with U5 snRNA, probably by binding to a purine-rich sequence located on the 3' side of U5 snRNA stem 1b. The SFPQ-NONO heteromer associated with MATR3 may play a role in nuclear retention of defective RNAs. The SFPQ-NONO heteromer may be involved in DNA unwinding by modulating the function of topoisomerase I/TOP1. The SFPQ-NONO heteromer may be involved in DNA nonhomologous end joining (NHEJ) required for double-strand break repair and V(D)J recombination and may stabilize paired DNA ends. In vitro, the complex strongly stimulates DNA end joining, binds directly to the DNA substrates and cooperates with the Ku70/G22P1-Ku80/XRCC5 (Ku) dimer to establish a functional preligation complex. NONO is involved in transcriptional regulation. The SFPQ-NONO-NR5A1 complex binds to the CYP17 promoter and regulates basal and cAMP-dependent transcriptional avtivity. NONO binds to an enhancer element in long terminal repeats of endogenous intracisternal A particles (IAPs) and activates transcription. Together with PSPC1, required for the formation of nuclear paraspeckles. A chromosomal aberration involving NONO may be a cause of papillary renal cell carcinoma (PRCC). Translocation t(X;X)(p11.2;q13.1) with TFE3.

Protein type: RNA splicing; RNA-binding; Nucleolus; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: Xq13.1

Cellular Component: membrane; nuclear matrix; nucleoplasm; nucleus; paraspeckles

Molecular Function: chromatin binding; identical protein binding; protein binding

Biological Process: circadian rhythm; mRNA processing; negative regulation of transcription, DNA-dependent; nuclear mRNA splicing, via spliceosome; regulation of circadian rhythm; regulation of transcription, DNA-dependent; RNA splicing

Disease: Mental Retardation, X-linked, Syndromic 34

Research Articles on NONO

Similar Products

Product Notes

The NONO nono (Catalog #AAA1277337) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccactcc gtggaaagca gctgcgtgtg cgctttgcct gccatagtgc atcccttaca gttcgaaacc ttcctcagta tgtgtccaac gaactgctgg aagaagcctt ttctgtgttt ggccaggtag agagggctgt agtcattgtg gatgatcgag gaaggccctc aggaaaaggc attgttgagt tctcagggaa gccagctgct cggaaagctc tggacagatg cagtgaaggc tccttcctgc taaccacatt tcctcgtcct gtgactgtgg agcccatgga ccagttagat gatgaagagg gacttccaga gaagctggtt ataaaaaacc agcaatttca caaggaacga gagcagccac ccagatttgc acagcctggc tcctttgagt atgaatatgc catgcgctgg aaggcactca ttgagatgga gaagcagcag caggaccaag tggaccgcaa catcaaggag gctcgtgaga agctggagat ggagatggaa gctgcacgcc atgagcacca ggtcatgcta atgagacagg atttgatgag gcgccaagaa gaacttcgga ggatggaaga gctgcacaac caagaggtgc aaaaacgaaa gcaactggag ctcaggcagg aggaagagcg caggcgccgt gaagaagaga tgcggcggca gcaagaagaa atgatgcggc gacagcagga aggattcaag ggaaccttcc ctgatgcgag agagcaggag attcggatgg gtcagatggc tatgggaggt gctatgggca taaacaacag aggtgccatg ccccctgctc ctgtgccagc tggtacccca gctcctccag gacctgccac tatgatgccg gatggaactt tgggattgac cccaccaaca actgaacgct ttggtcaggc tgctacaatg gaaggaattg gggcaattgg tggaactcct cctgcattca accgtgcagc tcctggagct gaatttgccc caaacaaacg tcgccgatac taa. It is sometimes possible for the material contained within the vial of "NONO, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual