NME7 cdna clone
NME7 cDNA Clone
Gene Names
NME7; NDK7; NDK 7; CFAP67; MN23H7; nm23-H7
Synonyms
NME7; NME7 cDNA Clone; NME7 cdna clone
Sequence
atgaatcatagtgaaagattcgttttcattgcagagtggtatgatccaaatgcttcacttcttcgacgttatgagcttttattttacccaggggatggatctgttgaaatgcatgatgtaaagaatcatcgcacctttttaaagcggaccaaatatgataacctgcacttggaagatttatttataggcaacaaagtgaatgtcttctctcgacaactggtattaattgactatggggatcaatatacagctcgccagctgggcagtaggaaagaaaaaacgctagccctaattaaaccagatgcaatatcaaaggctggagaaataattgaaataataaacaaagctggatttactataaccaaactcaaaatgatgatgctttcaaggaaagaagcattggattttcatgtagatcaccagtcaagaccctttttcaatgagctgatccagtttattacaactggtcctattattgccatggagattttaagagatgatgctatatgtgaatggaaaagactgctgggacctgcaaactctggagtggcacgcacagatgcttctgaaagcattagagccctctttggaacagatggcataagaaatgcagcgcatggccctgattcttttgcttctgcggccagagaaatggagttgttttttccttcaagtggaggttgtgggccggcaaacactgctaaatttactaattgtacctgttgcattgttaaaccccatgctgtcagtgaaggactgttgggaaagatcctgatggctatccgagatgcaggttttgaaatctcagctatgcagatgttcaatatggatcgggttaatgttgaggaattctatgaagtttataaaggagtagtgaccgaatatcatgacatggtgacagaaatgtattctggcccttgtgtagcaatggagattcaacagaataatgctacaaagacatttcgagaattttgtggacctgctgatcctgaaattgcccggcatttacgccctggaactctcagagcaatctttggtaaaactaagatccagaatgctgttcactgtactgatctgccagaggatggcctattagaggttcaatacttcttcaagatcttggataattag
Sequence Length
1131
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
38,187 Da
NCBI Official Full Name
Homo sapiens non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase), mRNA
NCBI Official Synonym Full Names
NME/NM23 family member 7
NCBI Official Symbol
NME7
NCBI Official Synonym Symbols
NDK7; NDK 7; CFAP67; MN23H7; nm23-H7
NCBI Protein Information
nucleoside diphosphate kinase 7
UniProt Protein Name
Nucleoside diphosphate kinase 7
Protein Family
UniProt Gene Name
NME7
UniProt Synonym Gene Names
NDK 7; NDP kinase 7
UniProt Entry Name
NDK7_HUMAN
Uniprot Description
NDK7: Major role in the synthesis of nucleoside triphosphates other than ATP. The ATP gamma phosphate is transferred to the NDP beta phosphate via a ping-pong mechanism, using a phosphorylated active-site intermediate. Belongs to the NDK family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 2.7.4.6; Nucleotide Metabolism - purine; Nucleotide Metabolism - pyrimidine; Kinase, nucleoside diphosphate; Kinase, other; Other group; NDK family
Chromosomal Location of Human Ortholog: 1q24
Cellular Component: centrosome
Molecular Function: nucleoside diphosphate kinase activity; protein binding
Research Articles on NME7
Similar Products
Product Notes
The NME7 nme7 (Catalog #AAA1269034) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatcata gtgaaagatt cgttttcatt gcagagtggt atgatccaaa tgcttcactt cttcgacgtt atgagctttt attttaccca ggggatggat ctgttgaaat gcatgatgta aagaatcatc gcaccttttt aaagcggacc aaatatgata acctgcactt ggaagattta tttataggca acaaagtgaa tgtcttctct cgacaactgg tattaattga ctatggggat caatatacag ctcgccagct gggcagtagg aaagaaaaaa cgctagccct aattaaacca gatgcaatat caaaggctgg agaaataatt gaaataataa acaaagctgg atttactata accaaactca aaatgatgat gctttcaagg aaagaagcat tggattttca tgtagatcac cagtcaagac cctttttcaa tgagctgatc cagtttatta caactggtcc tattattgcc atggagattt taagagatga tgctatatgt gaatggaaaa gactgctggg acctgcaaac tctggagtgg cacgcacaga tgcttctgaa agcattagag ccctctttgg aacagatggc ataagaaatg cagcgcatgg ccctgattct tttgcttctg cggccagaga aatggagttg ttttttcctt caagtggagg ttgtgggccg gcaaacactg ctaaatttac taattgtacc tgttgcattg ttaaacccca tgctgtcagt gaaggactgt tgggaaagat cctgatggct atccgagatg caggttttga aatctcagct atgcagatgt tcaatatgga tcgggttaat gttgaggaat tctatgaagt ttataaagga gtagtgaccg aatatcatga catggtgaca gaaatgtatt ctggcccttg tgtagcaatg gagattcaac agaataatgc tacaaagaca tttcgagaat tttgtggacc tgctgatcct gaaattgccc ggcatttacg ccctggaact ctcagagcaa tctttggtaa aactaagatc cagaatgctg ttcactgtac tgatctgcca gaggatggcc tattagaggt tcaatacttc ttcaagatct tggataatta g. It is sometimes possible for the material contained within the vial of "NME7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
