Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NME5 cdna clone

NME5 cDNA Clone

Gene Names
NME5; NM23H5; RSPH23; NM23-H5
Synonyms
NME5; NME5 cDNA Clone; NME5 cdna clone
Ordering
For Research Use Only!
Sequence
atggagatatcaatgcctccacctcagatatatgtagaaaaaactctggccattatcaaaccagatattgttgacaaagaggaggagatacaagatattattcttagatccggattcaccattgttcagagaagaaaactacgcctcagccctgagcaatgtagtaacttttatgtggaaaagtatggaaaaatgtttttccccaacttaacagcttacatgagttctggaccacttgtcgccatgatattagctagacataaagccatctcttattggttagaacttttgggaccaaataatagcttagtagcgaaggagacacatccagacagtctgagggcaatttatggcacagatgacctaaggaatgcacttcatgggagtaatgactttgctgctgcggaaagagaaatacgttttatgtttcctgaagtgattgttgagcccattccaattggacaagctgctaaggactatttaaatttacatataatgccaactctgcttgaaggactcacagagctttgtaagcaaaaaccagcagatcctttgatttggctagctgattggctgctgaaaaataatcctaacaaacccaaactttgtcaccatccaattgtagaagaaccttattaa
Sequence Length
639
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,236 Da
NCBI Official Full Name
Homo sapiens non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase), mRNA
NCBI Official Synonym Full Names
NME/NM23 family member 5
NCBI Official Symbol
NME5
NCBI Official Synonym Symbols
NM23H5; RSPH23; NM23-H5
NCBI Protein Information
nucleoside diphosphate kinase homolog 5
UniProt Protein Name
Nucleoside diphosphate kinase homolog 5
UniProt Gene Name
NME5
UniProt Synonym Gene Names
NDK-H 5; NDP kinase homolog 5; IPIA-beta
UniProt Entry Name
NDK5_HUMAN

Uniprot Description

NME5: Does not seem to have NDK kinase activity. Confers protection from cell death by Bax and alters the cellular levels of several antioxidant enzymes including Gpx5. May play a role in spermiogenesis by increasing the ability of late-stage spermatids to eliminate reactive oxygen species. Belongs to the NDK family.

Protein type: Kinase, nucleoside diphosphate; Kinase, other; Other group; NDK family

Chromosomal Location of Human Ortholog: 5q31

Cellular Component: intracellular

Molecular Function: protein binding

Biological Process: nucleoside metabolic process; spermatid development; spermatogenesis

Research Articles on NME5

Similar Products

Product Notes

The NME5 nme5 (Catalog #AAA1265811) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagatat caatgcctcc acctcagata tatgtagaaa aaactctggc cattatcaaa ccagatattg ttgacaaaga ggaggagata caagatatta ttcttagatc cggattcacc attgttcaga gaagaaaact acgcctcagc cctgagcaat gtagtaactt ttatgtggaa aagtatggaa aaatgttttt ccccaactta acagcttaca tgagttctgg accacttgtc gccatgatat tagctagaca taaagccatc tcttattggt tagaactttt gggaccaaat aatagcttag tagcgaagga gacacatcca gacagtctga gggcaattta tggcacagat gacctaagga atgcacttca tgggagtaat gactttgctg ctgcggaaag agaaatacgt tttatgtttc ctgaagtgat tgttgagccc attccaattg gacaagctgc taaggactat ttaaatttac atataatgcc aactctgctt gaaggactca cagagctttg taagcaaaaa ccagcagatc ctttgatttg gctagctgat tggctgctga aaaataatcc taacaaaccc aaactttgtc accatccaat tgtagaagaa ccttattaa. It is sometimes possible for the material contained within the vial of "NME5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.