NMD3 cdna clone
NMD3 cDNA Clone
Gene Names
NMD3; CGI-07
Synonyms
NMD3; NMD3 cDNA Clone; NMD3 cdna clone
Sequence
atggagtatatggcagaatccaccgaccgcagccctggacacatcttgtgctgtgagtgtggtgttccgataagtccaaatcctgccaatatttgtgtggcctgtttgcgaagtaaagtggacatcagccaaggtattccgaaacaagtctcgatttcgttctgcaaacaatgtcaaaggtattttcaaccaccaggaacttggatacagtgtgctttagaatccagggaacttcttgctttgtgcttgaaaaaaatcaaagcccctctgagtaaggtacggcttgtagatgcaggctttgtttggactgagcctcattctaagagacttaaagttaaactgactattcagaaagaggtgatgaatggtgctatccttcaacaagtgtttgtggtggattatgttgttcagtcccaaatgtgtggagattgccatagagtagaagctaaggatttctggaaggctgtgattcaagtgaggcaaaagactttgcataaaaaaactttctactatctggaacagttaattctgaaatatggaatgcatcagaatacacttcgtatcaaagagattcatgatggtctggatttttattattcctcaaaacaacatgctcagaagatggtcgaatttcttcagtgtacagttccctgtagatacaaagcatcacaaagactgatctctcaagatatccatagtaacacatacaattacaaaagcactttttctgtggaaattgttccaatatgcaaggataatgttgtctgtctgtctccaaaactggcacaaagcctgggaaatatgaaccagatttgtgtgtgtattcgagtaaccagtgccattcacctcattgatccaaacaccctacaagtggcagatattgatgggagcactttctggagtcaccctttcaatagtttatgtcatcccaaacagctagaggagtttattgtgatggaatgcagcatagtccaagatataaaacgtgctgcaggtgctggaatgatatcaaaaaagcataccctcggggaagtctgggtacagaagacatctgaaatgaatacagataaacagtatttttgtcgtactcatttgggacatcttctaaatcccggagacctggtgttagggtttgatttggccaactgtaacttaaatgatgagcatgtcaacaaaatgaactcagatagagttccagatgtggtattaatcaagaagagctatgaccggaccaaacgtcagcgtcgtagaaactggaaattgaaagagcttgcaagagagagagaaaacatggatacagatgatgaaaggcaataccaagattttcttgaagatcttgaagaagatgaggcaattcgaaaaaatgtcaacatttacagagattcagccatccctgtggaaagtgacaccgatgatgaaggagcacctcgaattagtctggctgagatgcttgaagaccttcatatttcccaagatgccactggtgaagaaggtgcatcaatgctgacataa
Sequence Length
1512
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
57,603 Da
NCBI Official Full Name
Homo sapiens NMD3 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
NMD3 ribosome export adaptor
NCBI Official Symbol
NMD3
NCBI Official Synonym Symbols
CGI-07
NCBI Protein Information
60S ribosomal export protein NMD3
UniProt Protein Name
60S ribosomal export protein NMD3
Protein Family
UniProt Gene Name
NMD3
UniProt Synonym Gene Names
hNMD3
UniProt Entry Name
NMD3_HUMAN
NCBI Description
Ribosomal 40S and 60S subunits associate in the nucleolus and are exported to the cytoplasm. The protein encoded by this gene is involved in the passage of the 60S subunit through the nuclear pore complex and into the cytoplasm. Several transcript variants exist for this gene, but the full-length natures of only two have been described to date. [provided by RefSeq, Feb 2016]
Uniprot Description
NMD3: Acts as an adapter for the XPO1/CRM1-mediated export of the 60S ribosomal subunit. Belongs to the NMD3 family.
Protein type: Nucleolus; Adaptor/scaffold
Chromosomal Location of Human Ortholog: 3q26.1
Cellular Component: cytoplasm; membrane; nucleolus; nucleoplasm; nucleus
Molecular Function: protein binding, bridging; ribosomal large subunit binding
Biological Process: ribosomal large subunit export from nucleus
Research Articles on NMD3
Similar Products
Product Notes
The NMD3 nmd3 (Catalog #AAA1274906) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtata tggcagaatc caccgaccgc agccctggac acatcttgtg ctgtgagtgt ggtgttccga taagtccaaa tcctgccaat atttgtgtgg cctgtttgcg aagtaaagtg gacatcagcc aaggtattcc gaaacaagtc tcgatttcgt tctgcaaaca atgtcaaagg tattttcaac caccaggaac ttggatacag tgtgctttag aatccaggga acttcttgct ttgtgcttga aaaaaatcaa agcccctctg agtaaggtac ggcttgtaga tgcaggcttt gtttggactg agcctcattc taagagactt aaagttaaac tgactattca gaaagaggtg atgaatggtg ctatccttca acaagtgttt gtggtggatt atgttgttca gtcccaaatg tgtggagatt gccatagagt agaagctaag gatttctgga aggctgtgat tcaagtgagg caaaagactt tgcataaaaa aactttctac tatctggaac agttaattct gaaatatgga atgcatcaga atacacttcg tatcaaagag attcatgatg gtctggattt ttattattcc tcaaaacaac atgctcagaa gatggtcgaa tttcttcagt gtacagttcc ctgtagatac aaagcatcac aaagactgat ctctcaagat atccatagta acacatacaa ttacaaaagc actttttctg tggaaattgt tccaatatgc aaggataatg ttgtctgtct gtctccaaaa ctggcacaaa gcctgggaaa tatgaaccag atttgtgtgt gtattcgagt aaccagtgcc attcacctca ttgatccaaa caccctacaa gtggcagata ttgatgggag cactttctgg agtcaccctt tcaatagttt atgtcatccc aaacagctag aggagtttat tgtgatggaa tgcagcatag tccaagatat aaaacgtgct gcaggtgctg gaatgatatc aaaaaagcat accctcgggg aagtctgggt acagaagaca tctgaaatga atacagataa acagtatttt tgtcgtactc atttgggaca tcttctaaat cccggagacc tggtgttagg gtttgatttg gccaactgta acttaaatga tgagcatgtc aacaaaatga actcagatag agttccagat gtggtattaa tcaagaagag ctatgaccgg accaaacgtc agcgtcgtag aaactggaaa ttgaaagagc ttgcaagaga gagagaaaac atggatacag atgatgaaag gcaataccaa gattttcttg aagatcttga agaagatgag gcaattcgaa aaaatgtcaa catttacaga gattcagcca tccctgtgga aagtgacacc gatgatgaag gagcacctcg aattagtctg gctgagatgc ttgaagacct tcatatttcc caagatgcca ctggtgaaga aggtgcatca atgctgacat aa. It is sometimes possible for the material contained within the vial of "NMD3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
