NLE1 cdna clone
NLE1 cDNA Clone
Gene Names
NLE1; Nle
Synonyms
NLE1; NLE1 cDNA Clone; NLE1 cdna clone
Sequence
atggcggcagcagtggcggacgaggcggtggcgcgcgatgtgcagcggttgctagtgcagttccaggatgagggcgggcagctgctgggttccccgttcgacgtgcccgtggacatcaccccggacaggctgcagctcgtgtgcaacgcgctactggcccaggaggatcccctgccactggctttctttgtccacgatgctgagatcgtctcctcactggggaagacgttggagtcccaggcagtggagacagagaaggtcctagacatcatctaccagccacaggctatcttcagagtccgggctgtgactcgctgcaccagctccttggagggtcacagtgaggcagtcatttctgtggccttcagccctacgggaaagtacctggccagtggctctggagacaccaccgtgcgcttctgggatctcagcacagagacaccacatttcacatgcaagggacacagacactgggtccttagtatatcctggtctccagatggcaagaagctggcctcaggctgcaagaatggccagattctcctctgggacccaagcacagggaagcaggtgggcaggaccctcgctggccacagcaagtggatcacaggcctgagctgggagcccctccatgcgaaccctgagtgccgctatgtggccagcagctccaaggatggcagtgtgcggatctgggacacaactgcaggccgctgtgagcgcatcctcaccgggcacacccagtcggtcacctgtctccggtggggaggggacgggcttctctactctgcctcccaggaccgcaccatcaaagtctggagagctcatgacggtgtgctgtgccggactctgcaaggccacggccactgggtgaacaccatggccctcagcactgactatgccctgcgcactggggcctttgaacctgctgaggcctcagttaatccccaagacctccaaggatccttgcaggagttgaaggagagggctctgagccgatacaacctcgtgcggggccagggtccagagaggctggtgtctggctccgacgacttcaccttattcctgtggtccccagcagaggacaaaaagcctctcactcggatgacaggacaccaagctctcatcaaccaggtgctcttctctcctgactcccgcatcgtggctagtgcctcctttgacaagtccatcaagctgtgggatggcaggacgggcaagtacctggcttccctacgcggccacgtggctgccgtgtaccagattgcgtggtcagctgacagtcggctcctggtcagcggcagcagtgacagcacactgaaggtgtgggatgtgaaggcccagaagctggccatggacctgcccggccacgcggatgaggtatatgctgttgactggagtccagatggccagagagtggcaagtggtgggaaggacaaatgcctccggatatggaggagatga
Sequence Length
1458
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
21,310 Da
NCBI Official Full Name
Homo sapiens notchless homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
notchless homolog 1
NCBI Official Symbol
NLE1
NCBI Official Synonym Symbols
Nle
NCBI Protein Information
notchless protein homolog 1
UniProt Protein Name
Notchless protein homolog 1
Protein Family
UniProt Gene Name
NLE1
UniProt Entry Name
NLE1_HUMAN
Uniprot Description
NLE1: Belongs to the NLE1/RSA4 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Nucleolus
Chromosomal Location of Human Ortholog: 17q12
Cellular Component: nucleolus; nucleus
Similar Products
Product Notes
The NLE1 nle1 (Catalog #AAA1274680) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcag cagtggcgga cgaggcggtg gcgcgcgatg tgcagcggtt gctagtgcag ttccaggatg agggcgggca gctgctgggt tccccgttcg acgtgcccgt ggacatcacc ccggacaggc tgcagctcgt gtgcaacgcg ctactggccc aggaggatcc cctgccactg gctttctttg tccacgatgc tgagatcgtc tcctcactgg ggaagacgtt ggagtcccag gcagtggaga cagagaaggt cctagacatc atctaccagc cacaggctat cttcagagtc cgggctgtga ctcgctgcac cagctccttg gagggtcaca gtgaggcagt catttctgtg gccttcagcc ctacgggaaa gtacctggcc agtggctctg gagacaccac cgtgcgcttc tgggatctca gcacagagac accacatttc acatgcaagg gacacagaca ctgggtcctt agtatatcct ggtctccaga tggcaagaag ctggcctcag gctgcaagaa tggccagatt ctcctctggg acccaagcac agggaagcag gtgggcagga ccctcgctgg ccacagcaag tggatcacag gcctgagctg ggagcccctc catgcgaacc ctgagtgccg ctatgtggcc agcagctcca aggatggcag tgtgcggatc tgggacacaa ctgcaggccg ctgtgagcgc atcctcaccg ggcacaccca gtcggtcacc tgtctccggt ggggagggga cgggcttctc tactctgcct cccaggaccg caccatcaaa gtctggagag ctcatgacgg tgtgctgtgc cggactctgc aaggccacgg ccactgggtg aacaccatgg ccctcagcac tgactatgcc ctgcgcactg gggcctttga acctgctgag gcctcagtta atccccaaga cctccaagga tccttgcagg agttgaagga gagggctctg agccgataca acctcgtgcg gggccagggt ccagagaggc tggtgtctgg ctccgacgac ttcaccttat tcctgtggtc cccagcagag gacaaaaagc ctctcactcg gatgacagga caccaagctc tcatcaacca ggtgctcttc tctcctgact cccgcatcgt ggctagtgcc tcctttgaca agtccatcaa gctgtgggat ggcaggacgg gcaagtacct ggcttcccta cgcggccacg tggctgccgt gtaccagatt gcgtggtcag ctgacagtcg gctcctggtc agcggcagca gtgacagcac actgaaggtg tgggatgtga aggcccagaa gctggccatg gacctgcccg gccacgcgga tgaggtatat gctgttgact ggagtccaga tggccagaga gtggcaagtg gtgggaagga caaatgcctc cggatatgga ggagatga. It is sometimes possible for the material contained within the vial of "NLE1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
