NIF3L1 cdna clone
NIF3L1 cDNA Clone
Gene Names
NIF3L1; CALS-7; MDS015; ALS2CR1
Synonyms
NIF3L1; NIF3L1 cDNA Clone; NIF3L1 cdna clone
Sequence
atgttgtcatcttgcgtacgcccagtccccacgacagtccggtttgtagattccctgatctgcaattcttcccgttccttcatggatttgaaggctctcctttcttccttgaatgactttgcatccctctcgtttgctgagagttgggacaatgttggattactggtggaaccaagcccaccacatactgtaaatacactcttcctgaccaatgacctgactgaggaagtgatggaggaggtgctgcaaaagaaggcagacctcattctctcctaccatccgcctatcttccgacccatgaagcgcataacctggaacacatggaaggagcgcctggtgatccgggctctggagaacagagtcggtatctactctcctcatacagcctatgatgctgcgccccagggcgtcaacaactggttggctaaagggcttggagcttgtacctccaggcccatacatccttccaaagctcccaactaccctacagagggaaaccaccgagtagaattcaacgttaactacacccaagacctggacaaagtcatgtctgcagtgaaaggaattgacggtgtttctgtcacttctttttctgctaggactggtaatgaggaacaaacacggattaatctgaattgtactcagaaggctttgatgcaggtggtagattttctttcccggaacaaacaactttatcagaagacggaaattctgtcactggagaagcctttgcttctacatactggaatgggacggttatgcacactggatgaatctgtctccctggcaaccatgattgatcgaataaaaagacacctaaaactatctcatattcgcttagcccttggggtggggagaaccttagagtctcaagtcaaagtcgtggccctgtgtgctggttctgggagcagcgttctgcagggtgttgaggctgacctttacctcacaggtgagatgtcccatcatgatactttggatgctgcttcccaaggaataaatgtcatcctctgtgaacacagcaacactgaacgaggctttctttctgaccttcgagatatgctggattctcacttggagaataagataaatattatcctatcagagactgacagggaccctcttcaggtggtataa
Sequence Length
1134
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
32,164 Da
NCBI Official Full Name
Homo sapiens NIF3 NGG1 interacting factor 3-like 1 (S. pombe), mRNA
NCBI Official Synonym Full Names
NGG1 interacting factor 3 like 1
NCBI Official Symbol
NIF3L1
NCBI Official Synonym Symbols
CALS-7; MDS015; ALS2CR1
NCBI Protein Information
NIF3-like protein 1
UniProt Protein Name
NIF3-like protein 1
UniProt Gene Name
NIF3L1
UniProt Entry Name
NIF3L_HUMAN
Uniprot Description
NIF3L1: Belongs to the UPF0135 (NIF3) family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 3.5.4.16; Transcription, coactivator/corepressor
Chromosomal Location of Human Ortholog: 2q33
Cellular Component: cytoplasm; mitochondrion; nucleus
Molecular Function: identical protein binding; protein binding; transcription factor binding
Biological Process: neuron differentiation; positive regulation of transcription, DNA-dependent
Research Articles on NIF3L1
Similar Products
Product Notes
The NIF3L1 nif3l1 (Catalog #AAA1266043) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttgtcat cttgcgtacg cccagtcccc acgacagtcc ggtttgtaga ttccctgatc tgcaattctt cccgttcctt catggatttg aaggctctcc tttcttcctt gaatgacttt gcatccctct cgtttgctga gagttgggac aatgttggat tactggtgga accaagccca ccacatactg taaatacact cttcctgacc aatgacctga ctgaggaagt gatggaggag gtgctgcaaa agaaggcaga cctcattctc tcctaccatc cgcctatctt ccgacccatg aagcgcataa cctggaacac atggaaggag cgcctggtga tccgggctct ggagaacaga gtcggtatct actctcctca tacagcctat gatgctgcgc cccagggcgt caacaactgg ttggctaaag ggcttggagc ttgtacctcc aggcccatac atccttccaa agctcccaac taccctacag agggaaacca ccgagtagaa ttcaacgtta actacaccca agacctggac aaagtcatgt ctgcagtgaa aggaattgac ggtgtttctg tcacttcttt ttctgctagg actggtaatg aggaacaaac acggattaat ctgaattgta ctcagaaggc tttgatgcag gtggtagatt ttctttcccg gaacaaacaa ctttatcaga agacggaaat tctgtcactg gagaagcctt tgcttctaca tactggaatg ggacggttat gcacactgga tgaatctgtc tccctggcaa ccatgattga tcgaataaaa agacacctaa aactatctca tattcgctta gcccttgggg tggggagaac cttagagtct caagtcaaag tcgtggccct gtgtgctggt tctgggagca gcgttctgca gggtgttgag gctgaccttt acctcacagg tgagatgtcc catcatgata ctttggatgc tgcttcccaa ggaataaatg tcatcctctg tgaacacagc aacactgaac gaggctttct ttctgacctt cgagatatgc tggattctca cttggagaat aagataaata ttatcctatc agagactgac agggaccctc ttcaggtggt ataa. It is sometimes possible for the material contained within the vial of "NIF3L1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
