Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NGF cdna clone

NGF cDNA Clone

Gene Names
NGF; NGFB; HSAN5; Beta-NGF
Synonyms
NGF; NGF cDNA Clone; NGF cdna clone
Ordering
For Research Use Only!
Sequence
atgtccatgttgttctacactctgatcacagcttttctgatcggcatacaggcggaaccacactcagagagcaatgtccctgcaggacacaccatcccccaagtccactggactaaacttcagcattcccttgacactgcccttcgcagagcccgcagcgccccggcagcggcgatagctgcacgcgtggcggggcagacccgcaacattactgtggaccccaggctgtttaaaaagcggcgactccgttcaccccgtgtgctgtttagcacccagcctccccgtgaagctgcagacactcaggatctggacttcgaggtcggtggtgctgcccccttcaacaggactcacaggagcaagcggtcatcatcccatcccatcttccacaggggcgaattctcggtgtgtgacagtgtcagcgtgtgggttggggataagaccaccgccacagacatcaagggcaaggaggtgatggtgttgggagaggtgaacattaacaacagtgtattcaaacagtacttttttgagaccaagtgccgggacccaaatcccgttgacagcgggtgccggggcattgactcaaagcactggaactcatattgtaccacgactcacacctttgtcaaggcgctgaccatggatggcaagcaggctgcctggcggtttatccggatagatacggcctgtgtgtgtgtgctcagcaggaaggctgtgagaagagcctga
Sequence Length
726
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,959 Da
NCBI Official Full Name
Homo sapiens nerve growth factor (beta polypeptide), mRNA
NCBI Official Synonym Full Names
nerve growth factor
NCBI Official Symbol
NGF
NCBI Official Synonym Symbols
NGFB; HSAN5; Beta-NGF
NCBI Protein Information
beta-nerve growth factor
UniProt Protein Name
Beta-nerve growth factor
Protein Family
UniProt Gene Name
NGF
UniProt Synonym Gene Names
NGFB; Beta-NGF
UniProt Entry Name
NGF_HUMAN

NCBI Description

This gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. This protein has nerve growth stimulating activity and the complex is involved in the regulation of growth and the differentiation of sympathetic and certain sensory neurons. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy, type 5 (HSAN5), and dysregulation of this gene's expression is associated with allergic rhinitis. [provided by RefSeq, Jul 2008]

Uniprot Description

NGF: Nerve growth factor is important for the development and maintenance of the sympathetic and sensory nervous systems. Extracellular ligand for the NTRK1 and NGFR receptors, activates cellular signaling cascades through those receptor tyrosine kinase to regulate neuronal proliferation, differentiation and survival. Homodimer. Belongs to the NGF-beta family.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 1p13.1

Cellular Component: cytoplasmic membrane-bound vesicle; endosome; extracellular region; Golgi lumen

Molecular Function: growth factor activity; metalloendopeptidase inhibitor activity; nerve growth factor receptor binding; protein binding

Biological Process: activation of MAPKK activity; caspase activation; cell-cell signaling; induction of apoptosis via death domain receptors; microtubule-based movement; negative regulation of apoptosis; negative regulation of caspase activity; negative regulation of neuron apoptosis; nerve growth factor processing; nerve growth factor receptor signaling pathway; neurite morphogenesis; phosphoinositide-mediated signaling; positive regulation of apoptosis; positive regulation of axonogenesis; positive regulation of Ras protein signal transduction; regulation of caspase activity; regulation of neuron differentiation; transmembrane receptor protein tyrosine kinase signaling pathway

Disease: Neuropathy, Hereditary Sensory And Autonomic, Type V

Research Articles on NGF

Similar Products

Product Notes

The NGF ngf (Catalog #AAA1277754) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccatgt tgttctacac tctgatcaca gcttttctga tcggcataca ggcggaacca cactcagaga gcaatgtccc tgcaggacac accatccccc aagtccactg gactaaactt cagcattccc ttgacactgc ccttcgcaga gcccgcagcg ccccggcagc ggcgatagct gcacgcgtgg cggggcagac ccgcaacatt actgtggacc ccaggctgtt taaaaagcgg cgactccgtt caccccgtgt gctgtttagc acccagcctc cccgtgaagc tgcagacact caggatctgg acttcgaggt cggtggtgct gcccccttca acaggactca caggagcaag cggtcatcat cccatcccat cttccacagg ggcgaattct cggtgtgtga cagtgtcagc gtgtgggttg gggataagac caccgccaca gacatcaagg gcaaggaggt gatggtgttg ggagaggtga acattaacaa cagtgtattc aaacagtact tttttgagac caagtgccgg gacccaaatc ccgttgacag cgggtgccgg ggcattgact caaagcactg gaactcatat tgtaccacga ctcacacctt tgtcaaggcg ctgaccatgg atggcaagca ggctgcctgg cggtttatcc ggatagatac ggcctgtgtg tgtgtgctca gcaggaaggc tgtgagaaga gcctga. It is sometimes possible for the material contained within the vial of "NGF, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.