NGDN cdna clone
NGDN cDNA Clone
Gene Names
NGDN; NGD; LCP5; CANu1; lpd-2; C14orf120
Synonyms
NGDN; NGDN cDNA Clone; NGDN cdna clone
Sequence
atggcggcgctgggggtgctggagtccgacctgccaagtgccgtgacacttctgaaaaatctccaggagcaagtgatggctgtaactgcacaagtgaaatcactgacacaaaaagttcaagctggtgcctatcctacagaaaagggtctcagcttcttggaagtgaaagaccagctgctgctcatgtaccttatggatttgacccacctcattctggacaaagcctcaggaggatctcttcagggacatgatgcagttttgagactggtagagattcgaacggttttggaaaagcttcgtcccttggaccaaaagctgaagtatcaaattgacaagctgatcaagactgcagtgacaggcagccttagtgagaatgacccacttcgttttaagcctcatcccagcaatatgatgagcaagttgagctctgaggatgaggaggaagatgaagcagaagatgaccagtctgaggcttcagggaagaaatctgtgaagggagtgtctaagaaatatgttcctccacgcttggttccagtacattatgatgaaacagaagctgagcgggagaagaagcgtctagaacgagccaagagacgggcattgagcagctctgtcattcgtgaacttaaggagcagtactcagatgctccagaggaaatccgtgatgctcggcatccccatgttacccgccagagtcaggaggaccaacacaggattaactatgaggagagcatgatggtgcgtttgagcgtcagtaagcgagagaaaggacggcgaaaacgagcaaatgtcatgagctcacaacttcattcccttacacacttcagtgacatcagtgctttgacagggggaactgttcatcttgatgaggatcagaatcctattaagaagcggaagaagatacctcagaaaggtcggaagaaaaaaggttttcggaggcggcggtga
Sequence Length
948
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
35,250 Da
NCBI Official Full Name
Homo sapiens neuroguidin, EIF4E binding protein, mRNA
NCBI Official Synonym Full Names
neuroguidin
NCBI Official Symbol
NGDN
NCBI Official Synonym Symbols
NGD; LCP5; CANu1; lpd-2; C14orf120
NCBI Protein Information
neuroguidin
UniProt Protein Name
Neuroguidin
Protein Family
UniProt Gene Name
NGDN
UniProt Synonym Gene Names
C14orf120; CANu1
UniProt Entry Name
NGDN_HUMAN
NCBI Description
Neuroguidin is an EIF4E (MIM 133440)-binding protein that interacts with CPEB (MIM 607342) and functions as a translational regulatory protein during development of the vertebrate nervous system (Jung et al., 2006 [PubMed 16705177]).[supplied by OMIM, Mar 2008]
Uniprot Description
NGDN: Involved in the translational repression of cytoplasmic polyadenylation element (CPE)-containing mRNAs. Belongs to the SAS10 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: RNA-binding; Nucleolus; Translation
Chromosomal Location of Human Ortholog: 14q11.2
Cellular Component: nucleolus; small subunit processome
Molecular Function: protein binding
Biological Process: maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)
Research Articles on NGDN
Similar Products
Product Notes
The NGDN ngdn (Catalog #AAA1267121) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgc tgggggtgct ggagtccgac ctgccaagtg ccgtgacact tctgaaaaat ctccaggagc aagtgatggc tgtaactgca caagtgaaat cactgacaca aaaagttcaa gctggtgcct atcctacaga aaagggtctc agcttcttgg aagtgaaaga ccagctgctg ctcatgtacc ttatggattt gacccacctc attctggaca aagcctcagg aggatctctt cagggacatg atgcagtttt gagactggta gagattcgaa cggttttgga aaagcttcgt cccttggacc aaaagctgaa gtatcaaatt gacaagctga tcaagactgc agtgacaggc agccttagtg agaatgaccc acttcgtttt aagcctcatc ccagcaatat gatgagcaag ttgagctctg aggatgagga ggaagatgaa gcagaagatg accagtctga ggcttcaggg aagaaatctg tgaagggagt gtctaagaaa tatgttcctc cacgcttggt tccagtacat tatgatgaaa cagaagctga gcgggagaag aagcgtctag aacgagccaa gagacgggca ttgagcagct ctgtcattcg tgaacttaag gagcagtact cagatgctcc agaggaaatc cgtgatgctc ggcatcccca tgttacccgc cagagtcagg aggaccaaca caggattaac tatgaggaga gcatgatggt gcgtttgagc gtcagtaagc gagagaaagg acggcgaaaa cgagcaaatg tcatgagctc acaacttcat tcccttacac acttcagtga catcagtgct ttgacagggg gaactgttca tcttgatgag gatcagaatc ctattaagaa gcggaagaag atacctcaga aaggtcggaa gaaaaaaggt tttcggaggc ggcggtga. It is sometimes possible for the material contained within the vial of "NGDN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
