Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NFYA cdna clone

NFYA cDNA Clone

Gene Names
NFYA; HAP2; CBF-A; CBF-B; NF-YA
Synonyms
NFYA; NFYA cDNA Clone; NFYA cdna clone
Ordering
For Research Use Only!
Sequence
atggagcagtatacagcaaacagcaatagttcgacagagcagattgttgtccaggcaggacagattcagcagcaggtccaagggcagccattaatggtgcaggtcagtggaggccagctaatcacatcaactggccaacccatcatggtccaggctgtccctggtgggcaaggtcaaaccatcatgcaagtacctgtttctggaacacagggtttgcagcaaatacagttggtcccacctggacagatccagatccagggtggacaggctgtgcaggtgcagggccagcagggccagacccagcagatcatcatccagcagccccagacggctgtcactgctggccagactcagacacagcagcagattgctgtccagggacagcaagtggcacagactgctgaagggcagaccatcgtctatcaaccagttaatgcagatggcaccattctccagcaagttacagtccctgtttcaggcatgatcactatcccagcagccagtttggcaggagcacagattgttcaaacaggagccaataccaacacaaccagcagtgggcaagggactgtcactgtgacactaccagtggcaggcaatgtggtcaattcaggagggatggtcatgatggttcctggggctggctctgtgcctgctatccaaagaatccctctacctggagcagagatgcttgaagaagagcctctctacgtgaatgccaaacaatacaaccgtattcttaagaggaggcaagcccgagctaaactagaggcagaagggaaaattccaaaggagagaaggaaatacctgcatgagtctcggcaccgtcatgccatggcacggaagcgtggtgaaggtggacgatttttctctccaaaggaaaaggatagtccccatatgcaggatccaaaccaagccgatgaagaagcaatgacacagatcatccgagtgtcctaa
Sequence Length
957
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,939 Da
NCBI Official Full Name
Homo sapiens nuclear transcription factor Y, alpha, mRNA
NCBI Official Synonym Full Names
nuclear transcription factor Y subunit alpha
NCBI Official Symbol
NFYA
NCBI Official Synonym Symbols
HAP2; CBF-A; CBF-B; NF-YA
NCBI Protein Information
nuclear transcription factor Y subunit alpha
UniProt Protein Name
Nuclear transcription factor Y subunit alpha
UniProt Gene Name
NFYA
UniProt Synonym Gene Names
NF-YA
UniProt Entry Name
NFYA_HUMAN

NCBI Description

The protein encoded by this gene is one subunit of a trimeric complex, forming a highly conserved transcription factor that binds to CCAAT motifs in the promoter regions in a variety of genes. Subunit A associates with a tight dimer composed of the B and C subunits, resulting in a trimer that binds to DNA with high specificity and affinity. The sequence specific interactions of the complex are made by the A subunit, suggesting a role as the regulatory subunit. In addition, there is evidence of post-transcriptional regulation in this gene product, either by protein degradation or control of translation. Further regulation is represented by alternative splicing in the glutamine-rich activation domain, with clear tissue-specific preferences for the two isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

NFYA: stimulates the transcription of various genes by recognizing and binding to a CCAAT motif in promoters, for example in type 1 collagen, albumin and beta-actin genes. Heterotrimeric transcription factor composed of three components, NF-YA, NF-YB and NF-YC. Involved in cisplatin resistance. NF-YB and NF-YC must interact and dimerize for NF-YA association and DNA binding. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 6p21.3

Cellular Component: CCAAT-binding factor complex; nucleoplasm; nucleus

Molecular Function: DNA binding; protein binding

Biological Process: positive regulation of transcription, DNA-dependent; regulation of transcription, DNA-dependent; transcription from RNA polymerase II promoter

Research Articles on NFYA

Similar Products

Product Notes

The NFYA nfya (Catalog #AAA1271980) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcagt atacagcaaa cagcaatagt tcgacagagc agattgttgt ccaggcagga cagattcagc agcaggtcca agggcagcca ttaatggtgc aggtcagtgg aggccagcta atcacatcaa ctggccaacc catcatggtc caggctgtcc ctggtgggca aggtcaaacc atcatgcaag tacctgtttc tggaacacag ggtttgcagc aaatacagtt ggtcccacct ggacagatcc agatccaggg tggacaggct gtgcaggtgc agggccagca gggccagacc cagcagatca tcatccagca gccccagacg gctgtcactg ctggccagac tcagacacag cagcagattg ctgtccaggg acagcaagtg gcacagactg ctgaagggca gaccatcgtc tatcaaccag ttaatgcaga tggcaccatt ctccagcaag ttacagtccc tgtttcaggc atgatcacta tcccagcagc cagtttggca ggagcacaga ttgttcaaac aggagccaat accaacacaa ccagcagtgg gcaagggact gtcactgtga cactaccagt ggcaggcaat gtggtcaatt caggagggat ggtcatgatg gttcctgggg ctggctctgt gcctgctatc caaagaatcc ctctacctgg agcagagatg cttgaagaag agcctctcta cgtgaatgcc aaacaataca accgtattct taagaggagg caagcccgag ctaaactaga ggcagaaggg aaaattccaa aggagagaag gaaatacctg catgagtctc ggcaccgtca tgccatggca cggaagcgtg gtgaaggtgg acgatttttc tctccaaagg aaaaggatag tccccatatg caggatccaa accaagccga tgaagaagca atgacacaga tcatccgagt gtcctaa. It is sometimes possible for the material contained within the vial of "NFYA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.