Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NFKBIE cdna clone

NFKBIE cDNA Clone

Gene Names
NFKBIE; IKBE
Synonyms
NFKBIE; NFKBIE cDNA Clone; NFKBIE cdna clone
Ordering
For Research Use Only!
Sequence
atgtcggaggcgcggaaggggccggacgaggcggaggagagccagtacgactctggcattgagtctctgcgctctctgcgctccctacccgagtccacctcggctccagcctccgggccctcggacggcagcccccagccctgcacccatcctccgggacccgtcaaggaaccacaggagaaggaagacgcggatggggagcgggctgattccacctatggctcctcctcgctcacctacaccctgtccttgctggggggccccgaggctgaggacccggccccacgcctgccactcccccacgtgggggcgctgagccctcagcagctggaagcactcacttacatctccgaggacggagacacgctggtccacctggcagtgattcatgaggccccagcggtgctgctctgttgcctggctttgctgccccaggaggtcctggacattcaaaataacctttaccagacagcactccatctggctgtacatctggaccaaccgggcgcagttcgggcactggtgctgaagggggccagccgggcactacaggaccggcatggtgacacagcccttcatgtggcctgccagcgccagcacttggcctgtgcccgctgcctgctggaagggcggccagagccaggcagaggaacatctcactctctggacctccagctgcaaaactggcaaggtctggcttgtctccacattgccacccttcagaagaaccaaccactcatggaattgctgcttcggaatggagctgacattgatgtgcaggagggcaccagtggtaagacagcgctgcacctggctgtggaaacccaagagcggggcctggtacagttcctgctccaggctggtgcccaggtagatgcccgcatgctgaacgggtgcacacccctgcacctggcagctggccggggtctcatgggcatctcatccactctgtgcaaggcgggtgctgactccctgctgcggaatgtggaggatgagacgccccaggacctgactgaggaatcccttgtccttttgccctttgatgacctgaagatctcagggaaactgctgctgtgtaccgactga
Sequence Length
1086
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,864 Da
NCBI Official Full Name
Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon, mRNA
NCBI Official Synonym Full Names
NFKB inhibitor epsilon
NCBI Official Symbol
NFKBIE
NCBI Official Synonym Symbols
IKBE
NCBI Protein Information
NF-kappa-B inhibitor epsilon
UniProt Protein Name
NF-kappa-B inhibitor epsilon
Protein Family
UniProt Gene Name
NFKBIE
UniProt Synonym Gene Names
IKBE; NF-kappa-BIE; IkB-E; IkB-epsilon; IkappaBepsilon
UniProt Entry Name
IKBE_HUMAN

NCBI Description

The protein encoded by this gene binds to components of NF-kappa-B, trapping the complex in the cytoplasm and preventing it from activating genes in the nucleus. Phosphorylation of the encoded protein targets it for destruction by the ubiquitin pathway, which activates NF-kappa-B by making it available to translocate to the nucleus. [provided by RefSeq, Sep 2011]

Uniprot Description

IkB-epsilon: Inhibits NF-kappa-B by complexing with and trapping it in the cytoplasm. Inhibits DNA-binding of NF-kappa-B p50-p65 and p50-c-Rel complexes. Interacts with RELA, REL, NFKB1 nuclear factor NF-kappa-B p50 subunit and NFKB2 nuclear factor NF-kappa-B p52 subunit. Highly expressed in spleen, testis and lung, followed by kidney, pancreas, heart, placenta and brain. Also expressed in granulocytes and macrophages. Belongs to the NF-kappa-B inhibitor family.

Protein type: Inhibitor; DNA-binding

Chromosomal Location of Human Ortholog: 6p21.1

Cellular Component: cytoplasm; cytosol

Molecular Function: protein binding

Biological Process: cytoplasmic sequestering of transcription factor

Research Articles on NFKBIE

Similar Products

Product Notes

The NFKBIE nfkbie (Catalog #AAA1275437) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggagg cgcggaaggg gccggacgag gcggaggaga gccagtacga ctctggcatt gagtctctgc gctctctgcg ctccctaccc gagtccacct cggctccagc ctccgggccc tcggacggca gcccccagcc ctgcacccat cctccgggac ccgtcaagga accacaggag aaggaagacg cggatgggga gcgggctgat tccacctatg gctcctcctc gctcacctac accctgtcct tgctgggggg ccccgaggct gaggacccgg ccccacgcct gccactcccc cacgtggggg cgctgagccc tcagcagctg gaagcactca cttacatctc cgaggacgga gacacgctgg tccacctggc agtgattcat gaggccccag cggtgctgct ctgttgcctg gctttgctgc cccaggaggt cctggacatt caaaataacc tttaccagac agcactccat ctggctgtac atctggacca accgggcgca gttcgggcac tggtgctgaa gggggccagc cgggcactac aggaccggca tggtgacaca gcccttcatg tggcctgcca gcgccagcac ttggcctgtg cccgctgcct gctggaaggg cggccagagc caggcagagg aacatctcac tctctggacc tccagctgca aaactggcaa ggtctggctt gtctccacat tgccaccctt cagaagaacc aaccactcat ggaattgctg cttcggaatg gagctgacat tgatgtgcag gagggcacca gtggtaagac agcgctgcac ctggctgtgg aaacccaaga gcggggcctg gtacagttcc tgctccaggc tggtgcccag gtagatgccc gcatgctgaa cgggtgcaca cccctgcacc tggcagctgg ccggggtctc atgggcatct catccactct gtgcaaggcg ggtgctgact ccctgctgcg gaatgtggag gatgagacgc cccaggacct gactgaggaa tcccttgtcc ttttgccctt tgatgacctg aagatctcag ggaaactgct gctgtgtacc gactga. It is sometimes possible for the material contained within the vial of "NFKBIE, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.