Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NFKBIA cdna clone

NFKBIA cDNA Clone

Gene Names
NFKBIA; IKBA; MAD-3; NFKBI
Synonyms
NFKBIA; NFKBIA cDNA Clone; NFKBIA cdna clone
Ordering
For Research Use Only!
Sequence
atgttccaggcggccgagcgcccccaggagtgggccatggagggcccccgcgacgggctgaagaaggagcggctactggacgaccgccacgacagcggcctggactccatgaaagacgaggagtacgagcagatggtcaaggagctgcaggagatccgcctcgagccgcaggaggtgccgcgcggctcggagccctggaagcagcagctcaccgaggacggggactcgttcctgcacttggccatcatccatgaagaaaaggcactgaccatggaagtgatccgccaggtgaagggagacctggctttcctcaacttccagaacaacctgcagcagactccactccacttggctgtgatcaccaaccagccagaaattgctgaggcacttctgggagctggctgtgatcctgagctccgagactttcgaggaaatacccccctacaccttgcctgtgagcagggctgcctggccagcgtgggagtcctgactcagtcctgcaccaccccgcacctccactccatcctgaaggctaccaactacaatggccacacgtgtctacacttagcctctatccatggctacctgggcatcgtggagcttttggtgtccttgggtgctgatgtcaatgctcaggagccctgtaatggccggactgcccttcacctcgcagtggacctgcaaaatcctgacctggtgtcactcctgttgaagtgtggggctgatgtcaacagagttacctaccagggctattctccctaccagctcacctggggccgcccaagcacccggatacagcagcagctgggccagctgacactagaaaaccttcagatgctgccagagagtgaggatgaggagagctatgacacagagtcagagttcacggagttcacagaggacgagctgccctatgatgactgtgtgtttggaggccagcgtctgacgttatga
Sequence Length
954
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,609 Da
NCBI Official Full Name
Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha, mRNA
NCBI Official Synonym Full Names
NFKB inhibitor alpha
NCBI Official Symbol
NFKBIA
NCBI Official Synonym Symbols
IKBA; MAD-3; NFKBI
NCBI Protein Information
NF-kappa-B inhibitor alpha
UniProt Protein Name
NF-kappa-B inhibitor alpha
Protein Family
UniProt Gene Name
NFKBIA
UniProt Synonym Gene Names
IKBA; MAD3; NFKBI; IkB-alpha; IkappaBalpha
UniProt Entry Name
IKBA_HUMAN

NCBI Description

This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease. [provided by RefSeq, Aug 2011]

Uniprot Description

IkB-alpha: a regulatory protein that inhibits NF-kappa-B by complexing with and trapping it in the cytoplasm. May be involved in regulation of transcriptional responses to NF-kappa-B, including cell adhesion, immune and proinflammatory responses, apoptosis, differentiation and growth. Controlled by sequential serine-phosphorylation, ubiquitination and degradation.

Protein type: DNA-binding; Inhibitor

Chromosomal Location of Human Ortholog: 14q13

Cellular Component: cytoplasm; cytosol; nucleus; plasma membrane

Molecular Function: enzyme binding; identical protein binding; NF-kappaB binding; nuclear localization sequence binding; protein binding; transcription factor binding; ubiquitin protein ligase binding

Biological Process: activation of NF-kappaB transcription factor; apoptosis; cytoplasmic sequestering of NF-kappaB; cytoplasmic sequestering of transcription factor; inhibition of NF-kappaB transcription factor; negative regulation of apoptosis; positive regulation of cellular protein metabolic process; positive regulation of transcription from RNA polymerase II promoter; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway

Disease: Ectodermal Dysplasia, Anhidrotic, With T-cell Immunodeficiency, Autosomal Dominant

Research Articles on NFKBIA

Similar Products

Product Notes

The NFKBIA nfkbia (Catalog #AAA1270069) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttccagg cggccgagcg cccccaggag tgggccatgg agggcccccg cgacgggctg aagaaggagc ggctactgga cgaccgccac gacagcggcc tggactccat gaaagacgag gagtacgagc agatggtcaa ggagctgcag gagatccgcc tcgagccgca ggaggtgccg cgcggctcgg agccctggaa gcagcagctc accgaggacg gggactcgtt cctgcacttg gccatcatcc atgaagaaaa ggcactgacc atggaagtga tccgccaggt gaagggagac ctggctttcc tcaacttcca gaacaacctg cagcagactc cactccactt ggctgtgatc accaaccagc cagaaattgc tgaggcactt ctgggagctg gctgtgatcc tgagctccga gactttcgag gaaatacccc cctacacctt gcctgtgagc agggctgcct ggccagcgtg ggagtcctga ctcagtcctg caccaccccg cacctccact ccatcctgaa ggctaccaac tacaatggcc acacgtgtct acacttagcc tctatccatg gctacctggg catcgtggag cttttggtgt ccttgggtgc tgatgtcaat gctcaggagc cctgtaatgg ccggactgcc cttcacctcg cagtggacct gcaaaatcct gacctggtgt cactcctgtt gaagtgtggg gctgatgtca acagagttac ctaccagggc tattctccct accagctcac ctggggccgc ccaagcaccc ggatacagca gcagctgggc cagctgacac tagaaaacct tcagatgctg ccagagagtg aggatgagga gagctatgac acagagtcag agttcacgga gttcacagag gacgagctgc cctatgatga ctgtgtgttt ggaggccagc gtctgacgtt atga. It is sometimes possible for the material contained within the vial of "NFKBIA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.