Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NFIL3 cdna clone

NFIL3 cDNA Clone

Gene Names
NFIL3; E4BP4; IL3BP1; NFIL3A; NF-IL3A
Synonyms
NFIL3; NFIL3 cDNA Clone; NFIL3 cdna clone
Ordering
For Research Use Only!
Sequence
atgcagctgagaaaaatgcagaccgtcaaaaaggagcaggcgtctcttgatgccagtagcaatgtggacaagatgatggtccttaattctgctttaacggaagtgtcagaagactccacaacaggtgaggagctgcttctcagtgaaggaagtgtggggaagaacaaatcttctgcatgtcggaggaaacgggaattcattcctgatgaaaagaaagatgctatgtattgggaaaaaaggcggaaaaataatgaagctgccaaaagatctcgtgagaagcgtcgactgaatgacctggttttagagaacaaactaattgcactgggagaagaaaacgccactttaaaagctgagctgctttcactaaaattaaagtttggtttaattagctccacagcatatgctcaagagattcagaaactcagtaattctacagctgtgtactttcaagattaccagacttccaaatccaatgtgagttcatttgtggacgagcacgaaccctcgatggtgtcaagtagttgtatttctgtcattaaacactctccacaaagctcgctgtccgatgtttcagaagtgtcctcagtagaacacacgcaggagagctctgtgcagggaagctgcagaagtcctgaaaacaagttccagattatcaagcaagagccgatggaattagagagctacacaagggagccaagagatgaccgaggctcttacacagcgtccatctatcaaaactatatggggaattctttctctgggtactcacactctcccccactactgcaagtcaaccgatcctccagcaactccccgagaacgtcggaaactgatgatggtgtggtaggaaagtcatctgatggagaagacgagcaacaggtccccaagggccccatccattctccagttgaactcaagcatgtgcatgcaactgtggttaaagttccagaagtgaattcctctgccttgccacacaagctccggatcaaagccaaagccatgcagatcaaagtagaagcctttgataatgaatttgaggccacgcaaaaactttcctcacctattgacatgacatctaaaagacatttcgaactcgaaaagcatagtgccccaagtatggtacattcttctcttactcctttctcagtgcaagtgactaacattcaagattggtctctcaaatcggagcactggcatcaaaaagaactgagtggcaaaactcagaatagtttcaaaactggagttgttgaaatgaaagacagtggctacaaagtttctgacccagagaacttgtatttgaagcaggggatagcaaacttatctgcagaggttgtctcactcaagagacttatagccacacaaccaatctctgcttcagactctgggtaa
Sequence Length
1389
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,472 Da
NCBI Official Full Name
Homo sapiens nuclear factor, interleukin 3 regulated, mRNA
NCBI Official Synonym Full Names
nuclear factor, interleukin 3 regulated
NCBI Official Symbol
NFIL3
NCBI Official Synonym Symbols
E4BP4; IL3BP1; NFIL3A; NF-IL3A
NCBI Protein Information
nuclear factor interleukin-3-regulated protein
UniProt Protein Name
Nuclear factor interleukin-3-regulated protein
UniProt Gene Name
NFIL3
UniProt Synonym Gene Names
E4BP4; IL3BP1
UniProt Entry Name
NFIL3_HUMAN

NCBI Description

The protein encoded by this gene is a transcriptional regulator that binds as a homodimer to activating transcription factor (ATF) sites in many cellular and viral promoters. The encoded protein represses PER1 and PER2 expression and therefore plays a role in the regulation of circadian rhythm. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2014]

Uniprot Description

E4BP4: Acts as a transcriptional regulator that recognizes and binds to the sequence 5'-[GA]TTA[CT]GTAA[CT]-3', a sequence present in many cellular and viral promoters. Represses transcription from promoters with activating transcription factor (ATF) sites. Represses promoter activity in osteoblasts. Represses transcriptional activity of PER1. Represses transcriptional activity of PER2 via the B- site on the promoter. Activates transcription from the interleukin-3 promoter in T-cells. Competes for the same consensus-binding site with PAR DNA-binding factors (DBP, HLF and TEF). Component of the circadian clock that acts as a negative regulator for the circadian expression of PER2 oscillation in the cell-autonomous core clock. Protects pro-B cells from programmed cell death. Belongs to the bZIP family. NFIL3 subfamily.

Protein type: Transcription factor; DNA-binding

Chromosomal Location of Human Ortholog: 9q22

Molecular Function: DNA binding; protein binding; transcription corepressor activity; transcription factor activity

Biological Process: circadian rhythm; negative regulation of transcription from RNA polymerase II promoter

Research Articles on NFIL3

Similar Products

Product Notes

The NFIL3 nfil3 (Catalog #AAA1276259) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagctga gaaaaatgca gaccgtcaaa aaggagcagg cgtctcttga tgccagtagc aatgtggaca agatgatggt ccttaattct gctttaacgg aagtgtcaga agactccaca acaggtgagg agctgcttct cagtgaagga agtgtgggga agaacaaatc ttctgcatgt cggaggaaac gggaattcat tcctgatgaa aagaaagatg ctatgtattg ggaaaaaagg cggaaaaata atgaagctgc caaaagatct cgtgagaagc gtcgactgaa tgacctggtt ttagagaaca aactaattgc actgggagaa gaaaacgcca ctttaaaagc tgagctgctt tcactaaaat taaagtttgg tttaattagc tccacagcat atgctcaaga gattcagaaa ctcagtaatt ctacagctgt gtactttcaa gattaccaga cttccaaatc caatgtgagt tcatttgtgg acgagcacga accctcgatg gtgtcaagta gttgtatttc tgtcattaaa cactctccac aaagctcgct gtccgatgtt tcagaagtgt cctcagtaga acacacgcag gagagctctg tgcagggaag ctgcagaagt cctgaaaaca agttccagat tatcaagcaa gagccgatgg aattagagag ctacacaagg gagccaagag atgaccgagg ctcttacaca gcgtccatct atcaaaacta tatggggaat tctttctctg ggtactcaca ctctccccca ctactgcaag tcaaccgatc ctccagcaac tccccgagaa cgtcggaaac tgatgatggt gtggtaggaa agtcatctga tggagaagac gagcaacagg tccccaaggg ccccatccat tctccagttg aactcaagca tgtgcatgca actgtggtta aagttccaga agtgaattcc tctgccttgc cacacaagct ccggatcaaa gccaaagcca tgcagatcaa agtagaagcc tttgataatg aatttgaggc cacgcaaaaa ctttcctcac ctattgacat gacatctaaa agacatttcg aactcgaaaa gcatagtgcc ccaagtatgg tacattcttc tcttactcct ttctcagtgc aagtgactaa cattcaagat tggtctctca aatcggagca ctggcatcaa aaagaactga gtggcaaaac tcagaatagt ttcaaaactg gagttgttga aatgaaagac agtggctaca aagtttctga cccagagaac ttgtatttga agcaggggat agcaaactta tctgcagagg ttgtctcact caagagactt atagccacac aaccaatctc tgcttcagac tctgggtaa. It is sometimes possible for the material contained within the vial of "NFIL3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.