Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NFATC3 cdna clone

NFATC3 cDNA Clone

Gene Names
NFATC3; NFAT4; NFATX
Synonyms
NFATC3; NFATC3 cDNA Clone; NFATC3 cdna clone
Ordering
For Research Use Only!
Sequence
atgactactgcaaactgtggcgcccacgacgagctcgacttcaaactcgtctttggcgaggacggggcgccggcgccgccgcccccgggctcgcggcctgcagatcttgagccagatgattgtgcatccatttacatctttaatgtagatccacctccatctactttaaccacaccactttgcttaccacatcatggattaccgtctcactcttctgttttgtcaccatcgtttcagctccaaagtcacaaaaactatgaaggaacttgtgagattcctgaatctaaatatagcccattaggtggtcccaaaccctttgagtgcccaagtattcaaattacatctatctctcctaactgtcatcaagaattagatgcacatgaagatgacctacagataaatgacccagaacgggaatttttggaaaggccttctagagatcatctctatcttcctcttgagccatcctaccgggagtcttctcttagtcctagtcctgccagcagcatctcttctaggagttggttctctgatgcatcttcttgtgaatcgctttcacatatttatgatgatgtggactcagagttgaatgaagctgcagcccgatttacccttggatcccctctgacttctcctggtggctctccagggggctgccctggagaagaaacttggcatcaacagtatggacttggacactcattatcacccaggcaatctccttgccactctcctagatccagtgtcactgatgagaattggctgagccccaggccagcctcaggaccctcatcaaggcccacatccccctgtgggaaacggaggcactccagtgctgaagtttgttatgctgggtccctttcaccccatcactcacctgttccttcacctggtcactcccccaggggaagtgtgacagaagatacgtggctcaatgcttctgtccatggtgggtcaggccttggccctgcagtttttccatttcagtactgtgtagagactgacatccctctcaaaacaaggaaaacttctgaagatcaagctgccatactaccaggaaaattagagctgtgttcagatgaccaagggagtttatcaccagcccgggagacttcaatagatgatggccttggatctcagtatcctttaaagaaagattcatgtggtgatcagtttctttcagttccttcaccctttacctggagcaaaccaaagcctggccacacccctatatttcgcacatcttcattacctccactagactggcctttaccagctcattttggacaatgtgaactgaaaatagaagtgcaacctaaaactcatcatcgagcccattatgaaactgaaggtagccgaggggcagtaaaagcatctactgggggacatcctgttgtgaagctcctgggctataacgaaaagccaataaatctacaaatgtttattgggacagcagatgatcgatatttacgacctcatgcattttaccaggtgcatcgaatcactgggaagacagtcgctactgcaagccaagagataataattgccagtacaaaagttctggaaattccacttcttcctgaaaataatatgtcagccagtattgattgtgcaggtattttgaaactccgcaattcagatatagaacttcgaaaaggagaaactgatattggcagaaagaatactagagtacgacttgtgtttcgtgtacacatcccacagcccagtggaaaagtcctttctctgcagatagcctctatacccgttgagtgctcccagcggtctgctcaagaacttcctcatattgagaagtacagtatcaacagttgttctgtaaatggaggtcatgaaatggttgtgactggatctaattttcttccagaatccaaaatcatttttcttgaaaaaggacaagatggacgacctcagtgggaggtagaagggaagataatcagggaaaaatgtcaaggggctcacattgtccttgaagttcctccatatcataacccagcagttacagctgcagtgcaggtgcacttttatctttgcaatggcaagaggaaaaaaagccagtctcaacgttttacttatacaccagttttgatgaagcaagaacacagagaagagattgatttgtcttcagttccatctttgcctgtgcctcatcctgctcagacccagaggccttcctctgattcagggtgttcacatgacagtgtactgtcaggacagagaagtttgatttgctccatcccacaaacatatgcatccatggtgacctcatcccatctgccacagttgcagtgtagagatgagagtgttagtaaagaacagcatatgattccttctccaattgtacaccagccttttcaagtcacaccaacacctcctgtggggtcttcctatcagcctatgcaaactaatgttgtgtacaatggaccaacttgtcttcctattaatgctgcctctagtcaagaatttgattcagttttgtttcagcaggatgcaactctttctggtttagtgaatcttggctgtcaaccactgtcatccataccatttcattcttcaaattcaggctcaacaggacatctcttagcccatacacctcattctgtgcataccctgcctcatctgcaatcaatgggatatcattgttcaaatacaggacaaagatctctttcttctccagtggctgaccagattacaggtcagccttcgtctcagttacaacctattacatatggtccttcacattcagggtctgctacaacagcttccccagcagcttctcatcccttggctagttcaccgctttctgggccaccatctcctcagcttcagcctatgccttaccaatctcctagctcaggaactgcctcatcaccgtctccagccaccagaatgcattctggacagcactcaactcaagcacaaagtacgggccaggggggtctttctgcaccttcatccttaatatgtcacagtttgtgtgatccagcgtcatttccacctgatggggcaactgtgagcattaaacctgaaccagaagatcgagagcctaactttgcaaccattggtctgcaggacatcactttagatgatgtgaacgagataattgggagagacatgtcccagatttctgtttcccaaggagcaggggtgagcaggcaggctcccctcccgagtcctgagtccctggatttaggaagatctgatgggctctaa
Sequence Length
3228
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
80,582 Da
NCBI Official Full Name
Homo sapiens nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3, mRNA
NCBI Official Synonym Full Names
nuclear factor of activated T-cells 3
NCBI Official Symbol
NFATC3
NCBI Official Synonym Symbols
NFAT4; NFATX
NCBI Protein Information
nuclear factor of activated T-cells, cytoplasmic 3
UniProt Protein Name
Nuclear factor of activated T-cells, cytoplasmic 3
UniProt Gene Name
NFATC3
UniProt Synonym Gene Names
NFAT4; NF-ATc3; NFATc3; NF-AT4
UniProt Entry Name
NFAC3_HUMAN

NCBI Description

The product of this gene is a member of the nuclear factors of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation and an inducible nuclear component. Other members of this family participate to form this complex also. The product of this gene plays a role in the regulation of gene expression in T cells and immature thymocytes. Several transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Nov 2010]

Uniprot Description

NFAT4: a transcription factor that plays a role in the inducible expression of cytokine genes in T cells. Plays a role in the regulation of gene expression in T cells and immature thymocytes. Six spliced isoforms have been identified. Isoform 1 is predominantly expressed in thymus, peripheral blood leukocytes and kidney. Isoform 2 is predominantly expressed in skeletal muscle and is also found in thymus, kidney, testis, spleen, prostate, ovary, small intestine, heart, placenta and pancreas. Isoform 3 is expressed in thymus and kidney. Isoform 4 is expressed in thymus and skeletal muscle.

Protein type: DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 16q22.2

Cellular Component: cytoplasm; cytosol; nucleolus; nucleoplasm; nucleus

Molecular Function: protein binding

Biological Process: inflammatory response; positive regulation of transcription from RNA polymerase II promoter; regulation of transcription from RNA polymerase II promoter; transcription from RNA polymerase II promoter

Research Articles on NFATC3

Similar Products

Product Notes

The NFATC3 nfatc3 (Catalog #AAA1269042) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactactg caaactgtgg cgcccacgac gagctcgact tcaaactcgt ctttggcgag gacggggcgc cggcgccgcc gcccccgggc tcgcggcctg cagatcttga gccagatgat tgtgcatcca tttacatctt taatgtagat ccacctccat ctactttaac cacaccactt tgcttaccac atcatggatt accgtctcac tcttctgttt tgtcaccatc gtttcagctc caaagtcaca aaaactatga aggaacttgt gagattcctg aatctaaata tagcccatta ggtggtccca aaccctttga gtgcccaagt attcaaatta catctatctc tcctaactgt catcaagaat tagatgcaca tgaagatgac ctacagataa atgacccaga acgggaattt ttggaaaggc cttctagaga tcatctctat cttcctcttg agccatccta ccgggagtct tctcttagtc ctagtcctgc cagcagcatc tcttctagga gttggttctc tgatgcatct tcttgtgaat cgctttcaca tatttatgat gatgtggact cagagttgaa tgaagctgca gcccgattta cccttggatc ccctctgact tctcctggtg gctctccagg gggctgccct ggagaagaaa cttggcatca acagtatgga cttggacact cattatcacc caggcaatct ccttgccact ctcctagatc cagtgtcact gatgagaatt ggctgagccc caggccagcc tcaggaccct catcaaggcc cacatccccc tgtgggaaac ggaggcactc cagtgctgaa gtttgttatg ctgggtccct ttcaccccat cactcacctg ttccttcacc tggtcactcc cccaggggaa gtgtgacaga agatacgtgg ctcaatgctt ctgtccatgg tgggtcaggc cttggccctg cagtttttcc atttcagtac tgtgtagaga ctgacatccc tctcaaaaca aggaaaactt ctgaagatca agctgccata ctaccaggaa aattagagct gtgttcagat gaccaaggga gtttatcacc agcccgggag acttcaatag atgatggcct tggatctcag tatcctttaa agaaagattc atgtggtgat cagtttcttt cagttccttc accctttacc tggagcaaac caaagcctgg ccacacccct atatttcgca catcttcatt acctccacta gactggcctt taccagctca ttttggacaa tgtgaactga aaatagaagt gcaacctaaa actcatcatc gagcccatta tgaaactgaa ggtagccgag gggcagtaaa agcatctact gggggacatc ctgttgtgaa gctcctgggc tataacgaaa agccaataaa tctacaaatg tttattggga cagcagatga tcgatattta cgacctcatg cattttacca ggtgcatcga atcactggga agacagtcgc tactgcaagc caagagataa taattgccag tacaaaagtt ctggaaattc cacttcttcc tgaaaataat atgtcagcca gtattgattg tgcaggtatt ttgaaactcc gcaattcaga tatagaactt cgaaaaggag aaactgatat tggcagaaag aatactagag tacgacttgt gtttcgtgta cacatcccac agcccagtgg aaaagtcctt tctctgcaga tagcctctat acccgttgag tgctcccagc ggtctgctca agaacttcct catattgaga agtacagtat caacagttgt tctgtaaatg gaggtcatga aatggttgtg actggatcta attttcttcc agaatccaaa atcatttttc ttgaaaaagg acaagatgga cgacctcagt gggaggtaga agggaagata atcagggaaa aatgtcaagg ggctcacatt gtccttgaag ttcctccata tcataaccca gcagttacag ctgcagtgca ggtgcacttt tatctttgca atggcaagag gaaaaaaagc cagtctcaac gttttactta tacaccagtt ttgatgaagc aagaacacag agaagagatt gatttgtctt cagttccatc tttgcctgtg cctcatcctg ctcagaccca gaggccttcc tctgattcag ggtgttcaca tgacagtgta ctgtcaggac agagaagttt gatttgctcc atcccacaaa catatgcatc catggtgacc tcatcccatc tgccacagtt gcagtgtaga gatgagagtg ttagtaaaga acagcatatg attccttctc caattgtaca ccagcctttt caagtcacac caacacctcc tgtggggtct tcctatcagc ctatgcaaac taatgttgtg tacaatggac caacttgtct tcctattaat gctgcctcta gtcaagaatt tgattcagtt ttgtttcagc aggatgcaac tctttctggt ttagtgaatc ttggctgtca accactgtca tccataccat ttcattcttc aaattcaggc tcaacaggac atctcttagc ccatacacct cattctgtgc ataccctgcc tcatctgcaa tcaatgggat atcattgttc aaatacagga caaagatctc tttcttctcc agtggctgac cagattacag gtcagccttc gtctcagtta caacctatta catatggtcc ttcacattca gggtctgcta caacagcttc cccagcagct tctcatccct tggctagttc accgctttct gggccaccat ctcctcagct tcagcctatg ccttaccaat ctcctagctc aggaactgcc tcatcaccgt ctccagccac cagaatgcat tctggacagc actcaactca agcacaaagt acgggccagg ggggtctttc tgcaccttca tccttaatat gtcacagttt gtgtgatcca gcgtcatttc cacctgatgg ggcaactgtg agcattaaac ctgaaccaga agatcgagag cctaactttg caaccattgg tctgcaggac atcactttag atgatgtgaa cgagataatt gggagagaca tgtcccagat ttctgtttcc caaggagcag gggtgagcag gcaggctccc ctcccgagtc ctgagtccct ggatttagga agatctgatg ggctctaa. It is sometimes possible for the material contained within the vial of "NFATC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.