NECAP2 cdna clone
NECAP2 cDNA Clone
Synonyms
NECAP2; NECAP2 cDNA Clone; NECAP2 cdna clone
Sequence
atggaggagagcgggtacgagtcggtgctctgtgtcaagcctgacgtccacgtctaccgcatccctccgcgggctaccaaccgtggctacagggctgcggagtggcagctggaccagccatcatggagtggccggctgaggatcactgcaaagggacagatggcctacatcaagctggaggacaggacgtcaggggagctctttgctcaggccccggtggatcagtttcctggcacagctgtggagagtgtgacggattccagcaggtacttcgtgatccgcatcgaagatggaaatgggcgacgggcgtttattggaattggcttcggggaccgaggtgatgcctttgacttcaatgttgcattgcaggaccatttcaagtgggtgaaacagcagtgtgaatttgcaaaacaagcccagaacccagaccaaggccctaaactggacctgggcttcaaggagggccagaccatcaagctcaacatcgcaaacatgaagaagaaggaaggagcagctgggaatccccgagtccggcctgccagcacaggagggctgagcctgcttccccctcccccaggggggaaaacctccaccctgatccctccccctggggagcagttggctgtggggggatccctcgtccagccagcagttgctcccagttcaggaggtgctcctgtaccctggccacagcccaatcctgccactgctgacatctggggagactttaccaaatctacaggatcaacttccagccagacccagccaggcacaggctgggtccagttctga
Sequence Length
792
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
25,267 Da
NCBI Official Full Name
Homo sapiens NECAP endocytosis associated 2, mRNA
NCBI Official Synonym Full Names
NECAP endocytosis associated 2
NCBI Official Symbol
NECAP2
NCBI Protein Information
adaptin ear-binding coat-associated protein 2
UniProt Protein Name
Adaptin ear-binding coat-associated protein 2
Protein Family
UniProt Gene Name
NECAP2
UniProt Synonym Gene Names
NECAP-2
UniProt Entry Name
NECP2_HUMAN
NCBI Description
This gene likely encodes a member of the adaptin-ear-binding coat-associated protein family. Studies of a similar protein in rat suggest a role in clathrin-mediated endocytosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Uniprot Description
NECAP2: Involved in endocytosis. Belongs to the NECAP family. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Vesicle
Chromosomal Location of Human Ortholog: 1p36.13
Cellular Component: clathrin vesicle coat; coated pit; intracellular
Biological Process: endocytosis
Research Articles on NECAP2
Similar Products
Product Notes
The NECAP2 necap2 (Catalog #AAA1267109) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggaga gcgggtacga gtcggtgctc tgtgtcaagc ctgacgtcca cgtctaccgc atccctccgc gggctaccaa ccgtggctac agggctgcgg agtggcagct ggaccagcca tcatggagtg gccggctgag gatcactgca aagggacaga tggcctacat caagctggag gacaggacgt caggggagct ctttgctcag gccccggtgg atcagtttcc tggcacagct gtggagagtg tgacggattc cagcaggtac ttcgtgatcc gcatcgaaga tggaaatggg cgacgggcgt ttattggaat tggcttcggg gaccgaggtg atgcctttga cttcaatgtt gcattgcagg accatttcaa gtgggtgaaa cagcagtgtg aatttgcaaa acaagcccag aacccagacc aaggccctaa actggacctg ggcttcaagg agggccagac catcaagctc aacatcgcaa acatgaagaa gaaggaagga gcagctggga atccccgagt ccggcctgcc agcacaggag ggctgagcct gcttccccct cccccagggg ggaaaacctc caccctgatc cctccccctg gggagcagtt ggctgtgggg ggatccctcg tccagccagc agttgctccc agttcaggag gtgctcctgt accctggcca cagcccaatc ctgccactgc tgacatctgg ggagacttta ccaaatctac aggatcaact tccagccaga cccagccagg cacaggctgg gtccagttct ga. It is sometimes possible for the material contained within the vial of "NECAP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
