Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NDUFS6 cdna clone

NDUFS6 cDNA Clone

Gene Names
NDUFS6; CI-13kA; CI13KDA; CI-13kD-A
Synonyms
NDUFS6; NDUFS6 cDNA Clone; NDUFS6 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggcgatgaccttctgccggctgctgaaccggtgtggcgaggcggcgcggagcctgcccctgggcgccaggtgtttcggggtgcgggtctcgccgaccggggagaaggtcacgcacactggccaggtttatgatgataaagactacaggagaattcggtttgtaggtcgtcagaaagaggtgaatgaaaactttgccattgatttgatagcagagcagcccgtgagcgaggtggagactcgggtgatagcgtgcgatggcggcgggggagctcttggccacccaaaagtgtatataaacttggacaaagaaacaaaaaccggcacatgcggttactgtgggctccagttcagacagcaccaccactag
Sequence Length
375
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,712 Da
NCBI Official Full Name
Homo sapiens NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase), mRNA
NCBI Official Synonym Full Names
NADH:ubiquinone oxidoreductase subunit S6
NCBI Official Symbol
NDUFS6
NCBI Official Synonym Symbols
CI-13kA; CI13KDA; CI-13kD-A
NCBI Protein Information
NADH dehydrogenase [ubiquinone] iron-sulfur protein 6, mitochondrial
UniProt Protein Name
NADH dehydrogenase [ubiquinone] iron-sulfur protein 6, mitochondrial
UniProt Gene Name
NDUFS6
UniProt Synonym Gene Names
CI-13kD-A
UniProt Entry Name
NDUS6_HUMAN

NCBI Description

This gene encodes a subunit of the NADH:ubiquinone oxidoreductase (complex I), which is the first enzyme complex in the electron transport chain of mitochondria. This complex functions in the transfer of electrons from NADH to the respiratory chain. The subunit encoded by this gene is one of seven subunits in the iron-sulfur protein fraction. Mutations in this gene cause mitochondrial complex I deficiency, a disease that causes a wide variety of clinical disorders, including neonatal disease and adult-onset neurodegenerative disorders.[provided by RefSeq, Oct 2009]

Uniprot Description

NDUFS6: Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Belongs to the complex I NDUFS6 subunit family.

Protein type: Energy Metabolism - oxidative phosphorylation; Oxidoreductase; EC 1.6.99.3; EC 1.6.5.3; Mitochondrial

Chromosomal Location of Human Ortholog: 5p15.33

Cellular Component: mitochondrial inner membrane; mitochondrial respiratory chain complex I

Biological Process: mitochondrial electron transport, NADH to ubiquinone; mitochondrial respiratory chain complex I assembly

Disease: Mitochondrial Complex I Deficiency

Research Articles on NDUFS6

Similar Products

Product Notes

The NDUFS6 ndufs6 (Catalog #AAA1272452) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg cgatgacctt ctgccggctg ctgaaccggt gtggcgaggc ggcgcggagc ctgcccctgg gcgccaggtg tttcggggtg cgggtctcgc cgaccgggga gaaggtcacg cacactggcc aggtttatga tgataaagac tacaggagaa ttcggtttgt aggtcgtcag aaagaggtga atgaaaactt tgccattgat ttgatagcag agcagcccgt gagcgaggtg gagactcggg tgatagcgtg cgatggcggc gggggagctc ttggccaccc aaaagtgtat ataaacttgg acaaagaaac aaaaaccggc acatgcggtt actgtgggct ccagttcaga cagcaccacc actag. It is sometimes possible for the material contained within the vial of "NDUFS6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.