NDC80 cdna clone
NDC80 cDNA Clone
Gene Names
NDC80; HEC; HEC1; TID3; KNTC2; HsHec1; hsNDC80
Synonyms
NDC80; NDC80 cDNA Clone; NDC80 cdna clone
Sequence
atgaagcgcagttcagtttccagcggtggtgctggccgcctctccatgcaggagttaagatcccaggatgtaaataaacaaggcctctatacccctcaaaccaaagagaaaccaacctttggaaagttgagtataaacaaaccgacatctgaaagaaaagtctcgctatttggcaaaagaactagtggacatggatcccggaatagtcaacttggtatattttccagttctgagaaaatcaaggacccgagaccacttaatgacaaagcattcattcagcagtgtattcgacaactctgtgagtttcttacagaaaatggttatgcacataatgtgtccatgaaatctctacaagctccctctgttaaagacttcctgaagatcttcacatttctttatggcttcctgtgcccctcatacgaacttcctgacacaaagtttgaagaagaggttccaagaatctttaaagaccttgggtatccttttgcactatccaaaagctccatgtacacagtgggggctcctcatacatggcctcacattgtggcagccttagtttggctaatagactgcatcaagatacatactgccatgaaagaaagctcacctttatttgatgatgggcagccttggggagaagaaactgaagatggaattatgcataataagttgtttttggactacaccataaaatgctatgagagttttatgagtggtgccgacagctttgatgagatgaatgcagagctgcagtcaaaactgaaggatttatttaatgtggatgcttttaagctggaatcattagaagcaaaaaacagagcattgaatgaacagattgcaagattggaacaagaaagagaaaaagaaccgaatcgtctagagtcgttgagaaaactgaaggcttccttacaaggagatgttcaaaagtatcaggcatacatgagcaatttggagtctcattcagccattcttgaccagaaattaaatggtctcaatgaggaaattgctagagtagaactagaatgtgaaacaataaaacaggagaacactcgactacagaatatcattgacaaccagaagtactcagttgcagacattgagcgaataaatcatgaaagaaatgaattgcagcagactattaataaattaaccaaggacctggaagctgaacaacagaagttgtggaatgaggagttaaaatatgccagaggcaaagaagcgattgaaacacaattagcagagtatcacaaattggctagaaaattaaaacttattcctaaaggtgctgagaattccaaaggttatgactttgaaattaagtttaatcccgaggctggtgccaactgccttgtcaaatacagggctcaagtttatgtacctcttaaggaactcctgaatgaaactgaagaagaaattaataaagccctaaataaaaaaatgggtttggaggatactttagaacaattgaatgcaatgataacagaaagcaagagaagtgtgagaactctgaaagaagaagttcaaaagctggatgatctttaccaacaaaaaattaaggaagcagaggaagaggatgaaaaatgtgccagtgagcttgagtccttggagaaacacaagcacctgctagaaagtactgttaaccaggggctcagtgaagctatgaatgaattagatgctgttcagcgggaataccaactagttgtgcaaaccacgactgaagaaagacgaaaagtgggaaataacttgcaacgtctgttagagatggttgctacacatgttgggtctgtagagaaacatcttgaggagcagattgctaaagttgatagagaatatgaagaatgcatgtcagaagatctctcggaaaatattaaagagattagagataagtatgagaagaaagctactctaattaagtcttctgaagaatga
Sequence Length
1929
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
73,913 Da
NCBI Official Full Name
Homo sapiens NDC80 homolog, kinetochore complex component (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
NDC80, kinetochore complex component
NCBI Official Symbol
NDC80
NCBI Official Synonym Symbols
HEC; HEC1; TID3; KNTC2; HsHec1; hsNDC80
NCBI Protein Information
kinetochore protein NDC80 homolog
UniProt Protein Name
Kinetochore protein NDC80 homolog
Protein Family
UniProt Gene Name
NDC80
UniProt Synonym Gene Names
HEC; HEC1; KNTC2; HsHec1
UniProt Entry Name
NDC80_HUMAN
NCBI Description
This gene encodes a component of the NDC80 kinetochore complex. The encoded protein consists of an N-terminal microtubule binding domain and a C-terminal coiled-coiled domain that interacts with other components of the complex. This protein functions to organize and stabilize microtubule-kinetochore interactions and is required for proper chromosome segregation. [provided by RefSeq, Oct 2011]
Uniprot Description
HEC1: plays an essential role in chromosome segregation by interacting through its coiled-coil domains with several proteins that modulate the G2/M phase. Phosphorylation by Nek2 is essential for faithful chromosome segregation. Required for the recruitment of Mps1 kinase and Mad1/Mad2 complexes to kinetochores.
Protein type: Cell cycle regulation
Chromosomal Location of Human Ortholog: 18p11.32
Cellular Component: chromosome, pericentric region; cytosol; kinetochore; membrane; nucleus
Molecular Function: identical protein binding; protein binding; structural constituent of cytoskeleton
Biological Process: attachment of spindle microtubules to kinetochore; attachment of spindle microtubules to kinetochore during mitosis; chromosome segregation; establishment of mitotic spindle orientation; mitosis; mitotic sister chromatid segregation; mitotic spindle organization and biogenesis; sister chromatid cohesion
Research Articles on NDC80
Similar Products
Product Notes
The NDC80 ndc80 (Catalog #AAA1274793) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagcgca gttcagtttc cagcggtggt gctggccgcc tctccatgca ggagttaaga tcccaggatg taaataaaca aggcctctat acccctcaaa ccaaagagaa accaaccttt ggaaagttga gtataaacaa accgacatct gaaagaaaag tctcgctatt tggcaaaaga actagtggac atggatcccg gaatagtcaa cttggtatat tttccagttc tgagaaaatc aaggacccga gaccacttaa tgacaaagca ttcattcagc agtgtattcg acaactctgt gagtttctta cagaaaatgg ttatgcacat aatgtgtcca tgaaatctct acaagctccc tctgttaaag acttcctgaa gatcttcaca tttctttatg gcttcctgtg cccctcatac gaacttcctg acacaaagtt tgaagaagag gttccaagaa tctttaaaga ccttgggtat ccttttgcac tatccaaaag ctccatgtac acagtggggg ctcctcatac atggcctcac attgtggcag ccttagtttg gctaatagac tgcatcaaga tacatactgc catgaaagaa agctcacctt tatttgatga tgggcagcct tggggagaag aaactgaaga tggaattatg cataataagt tgtttttgga ctacaccata aaatgctatg agagttttat gagtggtgcc gacagctttg atgagatgaa tgcagagctg cagtcaaaac tgaaggattt atttaatgtg gatgctttta agctggaatc attagaagca aaaaacagag cattgaatga acagattgca agattggaac aagaaagaga aaaagaaccg aatcgtctag agtcgttgag aaaactgaag gcttccttac aaggagatgt tcaaaagtat caggcataca tgagcaattt ggagtctcat tcagccattc ttgaccagaa attaaatggt ctcaatgagg aaattgctag agtagaacta gaatgtgaaa caataaaaca ggagaacact cgactacaga atatcattga caaccagaag tactcagttg cagacattga gcgaataaat catgaaagaa atgaattgca gcagactatt aataaattaa ccaaggacct ggaagctgaa caacagaagt tgtggaatga ggagttaaaa tatgccagag gcaaagaagc gattgaaaca caattagcag agtatcacaa attggctaga aaattaaaac ttattcctaa aggtgctgag aattccaaag gttatgactt tgaaattaag tttaatcccg aggctggtgc caactgcctt gtcaaataca gggctcaagt ttatgtacct cttaaggaac tcctgaatga aactgaagaa gaaattaata aagccctaaa taaaaaaatg ggtttggagg atactttaga acaattgaat gcaatgataa cagaaagcaa gagaagtgtg agaactctga aagaagaagt tcaaaagctg gatgatcttt accaacaaaa aattaaggaa gcagaggaag aggatgaaaa atgtgccagt gagcttgagt ccttggagaa acacaagcac ctgctagaaa gtactgttaa ccaggggctc agtgaagcta tgaatgaatt agatgctgtt cagcgggaat accaactagt tgtgcaaacc acgactgaag aaagacgaaa agtgggaaat aacttgcaac gtctgttaga gatggttgct acacatgttg ggtctgtaga gaaacatctt gaggagcaga ttgctaaagt tgatagagaa tatgaagaat gcatgtcaga agatctctcg gaaaatatta aagagattag agataagtat gagaagaaag ctactctaat taagtcttct gaagaatga. It is sometimes possible for the material contained within the vial of "NDC80, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
