Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NCSTN cdna clone

NCSTN cDNA Clone

Gene Names
NCSTN; ATAG1874
Synonyms
NCSTN; NCSTN cDNA Clone; NCSTN cdna clone
Ordering
For Research Use Only!
Sequence
atggactttaatctcattttagaaagtttgtgcaggggaaactcagtggagaggaagatatatatccccttaaataaaacagctccctgtgttcgcctgctcaacgccactcatcagattggctgccagtcttcaattagtggagacacaggggttatccacgtagtagagaaagaggaggacctacagtgggtattgactgatggccccaaccccccttacatggttctgctggagagcaagcattttaccagggatttaatggagaagctgaaagggagaaccagccgaattgctggtcttgcagtgtccttgaccaagcccagtcctgcctcaggcttctctcctagtgtacagtgcccaaatgatgggtttggtgtttactccaattcctatgggccagagtttgctcactgcagagaaatacagtggaattcgctgggcaatggtttggcttatgaagactttagtttccccatctttcttcttgaagatgaaaatgaaaccaaagtcatcaagcagtgctatcaagatcacaacctgagtcagaatggctcagcaccaaccttcccactatgtgccatgcagctcttttcacacatgcatgctgtcatcagcactgccacctgcatgcggcgcagctccatccaaagcaccttcagcatcaacccagaaatcgtctgtgaccccctgtctgattacaatgtgtggagcatgctaaagcctataaatacaactgggacattaaagcctgacgacagggttgtggttgctgccacccggctggatagtcgttcctttttctggaatgtggccccaggggctgaaagcgcagtggcttcctttgtcacccagctggctgctgctgaagctttgcaaaaggcacctgatgtgaccaccctgccccgcaatgtcatgtttgtcttctttcaaggggaaacttttgactacattggcagctcgaggatggtctacgatatggagaagggcaagtttcccgtgcagttagagaatgttgactcatttgtggagctgggacaggtggccttaagaacttcattagagctttggatgcacacagatcctgtttctcagaaaaatgagtctgtacggaaccaggtggaggatctcctggccacattggagaagagtggtgctggtgtccctgctgtcatcctcaggaggccaaatcagtcccagcctctcccaccatcttccctgcagcgatttcttcgagctcgaaacatctctggcgttgttctggctgaccactctggtgccttccataacaaatattaccagagtatttacgacactgctgagaacattaatgtgagctatcccgaatggctgagccctgaagaggacctgaactttgtaacagacactgccaaggccctggcagatgtggccacggtgctgggacgtgctctgtatgagcttgcaggaggaaccaacttcagcgacacagttcaggctgatccccaaacggttacccgcctgctctatgggttcctgattaaagccaacaactcatggttccagtctatcctcaggcaggacctaaggtcctacttgggtgacgggcctcttcaacattacatcgctgtctccagccccaccaacaccacttatgttgtacagtatgccttggcaaatttgactggcacagtggtcaacctcacccgagagcagtgccaggatccaagtaaagtcccaagtgaaaacaaggatctgtatgagtactcatgggtccagggccctttgcattctaatgagacggaccgactcccccggtgtgtgcgttctactgcacgattagccagggccttgtctcctgcctttgaactgagtcagtggagctctactgaatactctacatggactgagagccgctggaaagatatccatgcccggatatttctcatcgccagcaaagagcttgagttgatcaccctgacagtgggcttcggcatcctcatcttctccctcatcgtcacctactgcatcaatgccaaagctgatgtccttttcattgctccccgggagccaggagctgtgtcatactga
Sequence Length
2070
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
76,744 Da
NCBI Official Full Name
Homo sapiens nicastrin, mRNA
NCBI Official Synonym Full Names
nicastrin
NCBI Official Symbol
NCSTN
NCBI Official Synonym Symbols
ATAG1874
NCBI Protein Information
nicastrin
UniProt Protein Name
Nicastrin
Protein Family
UniProt Gene Name
NCSTN
UniProt Synonym Gene Names
KIAA0253
UniProt Entry Name
NICA_HUMAN

NCBI Description

This gene encodes a type I transmembrane glycoprotein that is an integral component of the multimeric gamma-secretase complex. The encoded protein cleaves integral membrane proteins, including Notch receptors and beta-amyloid precursor protein, and may be a stabilizing cofactor required for gamma-secretase complex assembly. The cleavage of beta-amyloid precursor protein yields amyloid beta peptide, the main component of the neuritic plaque and the hallmark lesion in the brains of patients with Alzheimer's disease; however, the nature of the encoded protein's role in Alzheimer's disease is not known for certain. Mutations in this gene are associated with familial acne inversa. A pseudogene of this gene is present on chromosome 21. Alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Feb 2014]

Uniprot Description

nicastrin: Essential subunit of the gamma-secretase complex, an endoprotease complex that catalyzes the intramembrane cleavage of integral membrane proteins such as Notch receptors and APP (beta- amyloid precursor protein). It probably represents a stabilizing cofactor required for the assembly of the gamma-secretase complex. Component of the gamma-secretase complex, a complex composed of a presenilin homodimer (PSEN1 or PSEN2), nicastrin (NCSTN), APH1 (APH1A or APH1B) and PEN2. Such minimal complex is sufficient for secretase activity, although other components may exist. Binds to proteolytic processed C-terminal fragments C83 and C99 of the amyloid precursor protein (APP). Constitutively expressed in neural cells. Widely expressed. Belongs to the nicastrin family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 1q22-q23

Cellular Component: endoplasmic reticulum; focal adhesion; Golgi apparatus; integral to plasma membrane; lysosomal membrane; membrane; plasma membrane

Molecular Function: protein binding

Biological Process: amyloid precursor protein catabolic process; ephrin receptor signaling pathway; membrane protein ectodomain proteolysis; membrane protein intracellular domain proteolysis; Notch receptor processing; Notch signaling pathway; positive regulation of apoptosis; positive regulation of catalytic activity; protein processing

Disease: Acne Inversa, Familial, 1

Research Articles on NCSTN

Similar Products

Product Notes

The NCSTN ncstn (Catalog #AAA1266872) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacttta atctcatttt agaaagtttg tgcaggggaa actcagtgga gaggaagata tatatcccct taaataaaac agctccctgt gttcgcctgc tcaacgccac tcatcagatt ggctgccagt cttcaattag tggagacaca ggggttatcc acgtagtaga gaaagaggag gacctacagt gggtattgac tgatggcccc aacccccctt acatggttct gctggagagc aagcatttta ccagggattt aatggagaag ctgaaaggga gaaccagccg aattgctggt cttgcagtgt ccttgaccaa gcccagtcct gcctcaggct tctctcctag tgtacagtgc ccaaatgatg ggtttggtgt ttactccaat tcctatgggc cagagtttgc tcactgcaga gaaatacagt ggaattcgct gggcaatggt ttggcttatg aagactttag tttccccatc tttcttcttg aagatgaaaa tgaaaccaaa gtcatcaagc agtgctatca agatcacaac ctgagtcaga atggctcagc accaaccttc ccactatgtg ccatgcagct cttttcacac atgcatgctg tcatcagcac tgccacctgc atgcggcgca gctccatcca aagcaccttc agcatcaacc cagaaatcgt ctgtgacccc ctgtctgatt acaatgtgtg gagcatgcta aagcctataa atacaactgg gacattaaag cctgacgaca gggttgtggt tgctgccacc cggctggata gtcgttcctt tttctggaat gtggccccag gggctgaaag cgcagtggct tcctttgtca cccagctggc tgctgctgaa gctttgcaaa aggcacctga tgtgaccacc ctgccccgca atgtcatgtt tgtcttcttt caaggggaaa cttttgacta cattggcagc tcgaggatgg tctacgatat ggagaagggc aagtttcccg tgcagttaga gaatgttgac tcatttgtgg agctgggaca ggtggcctta agaacttcat tagagctttg gatgcacaca gatcctgttt ctcagaaaaa tgagtctgta cggaaccagg tggaggatct cctggccaca ttggagaaga gtggtgctgg tgtccctgct gtcatcctca ggaggccaaa tcagtcccag cctctcccac catcttccct gcagcgattt cttcgagctc gaaacatctc tggcgttgtt ctggctgacc actctggtgc cttccataac aaatattacc agagtattta cgacactgct gagaacatta atgtgagcta tcccgaatgg ctgagccctg aagaggacct gaactttgta acagacactg ccaaggccct ggcagatgtg gccacggtgc tgggacgtgc tctgtatgag cttgcaggag gaaccaactt cagcgacaca gttcaggctg atccccaaac ggttacccgc ctgctctatg ggttcctgat taaagccaac aactcatggt tccagtctat cctcaggcag gacctaaggt cctacttggg tgacgggcct cttcaacatt acatcgctgt ctccagcccc accaacacca cttatgttgt acagtatgcc ttggcaaatt tgactggcac agtggtcaac ctcacccgag agcagtgcca ggatccaagt aaagtcccaa gtgaaaacaa ggatctgtat gagtactcat gggtccaggg ccctttgcat tctaatgaga cggaccgact cccccggtgt gtgcgttcta ctgcacgatt agccagggcc ttgtctcctg cctttgaact gagtcagtgg agctctactg aatactctac atggactgag agccgctgga aagatatcca tgcccggata tttctcatcg ccagcaaaga gcttgagttg atcaccctga cagtgggctt cggcatcctc atcttctccc tcatcgtcac ctactgcatc aatgccaaag ctgatgtcct tttcattgct ccccgggagc caggagctgt gtcatactga. It is sometimes possible for the material contained within the vial of "NCSTN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.