Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NCF4 cdna clone

NCF4 cDNA Clone

Gene Names
NCF4; NCF; CGD3; P40PHOX; SH3PXD4
Synonyms
NCF4; NCF4 cDNA Clone; NCF4 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgtggcccagcagctgcgggccgagagtgactttgaacagcttccggatgatgttgccatctcggccaacattgctgacatcgaggagaagagaggcttcaccagccactttgttttcgtcatcgaggtgaagacaaaaggaggatccaagtacctcatctaccgccgctaccgccagttccatgctttgcagagcaagctggaggagcgcttcgggccagacagcaagagcagtgccctggcctgtaccctgcccacactcccagccaaagtctacgtgggtgtgaaacaggagatcgccgagatgcggatacctgccctcaacgcctacatgaagagcctgctcagcctgccggtctgggtgctgatggatgaggacgtccggatcttcttttaccagtcgccctatgactcagagcaggtgccccaggcactccgccggctccgcccgcgcacccggaaagtcaagagcgtgtccccacagggcaacagcgttgaccgcatggcagctccgagagcagaggctctatttgacttcactggaaacagcaaactggagctgaatttcaaagctggagatgtgatcttcctcctcagtcggatcaacaaagactggctggagggcactgtccggggagccacgggcatcttccctctctccttcgtgaagatcctcaaagacttccctgaggaggacgaccccaccaactggctgcgttgctactactacgaagacaccatcagcaccatcaagtctgtggcctgggagggaggggcctgtccagccttcctgccatccctacgaccaccgcccctcacatcaccttctcatgggtccctctcccactccaaagcccccagtggctcccagatgagccacaatgctgtaacaagccatcaacgtccagggtggcctggccagcctcattcccctttcccccaccccacaccccacttccagcctgatgcctccttactccagcctgtcacccccttagggacatcgcggtggaggaagatctcagcagcactcccctattga
Sequence Length
1047
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,017 Da
NCBI Official Full Name
Homo sapiens neutrophil cytosolic factor 4, 40kDa, mRNA
NCBI Official Synonym Full Names
neutrophil cytosolic factor 4
NCBI Official Symbol
NCF4
NCBI Official Synonym Symbols
NCF; CGD3; P40PHOX; SH3PXD4
NCBI Protein Information
neutrophil cytosol factor 4
UniProt Protein Name
Neutrophil cytosol factor 4
Protein Family
UniProt Gene Name
NCF4
UniProt Synonym Gene Names
SH3PXD4; NCF-4; p40phox
UniProt Entry Name
NCF4_HUMAN

NCBI Description

The protein encoded by this gene is a cytosolic regulatory component of the superoxide-producing phagocyte NADPH-oxidase, a multicomponent enzyme system important for host defense. This protein is preferentially expressed in cells of myeloid lineage. It interacts primarily with neutrophil cytosolic factor 2 (NCF2/p67-phox) to form a complex with neutrophil cytosolic factor 1 (NCF1/p47-phox), which further interacts with the small G protein RAC1 and translocates to the membrane upon cell stimulation. This complex then activates flavocytochrome b, the membrane-integrated catalytic core of the enzyme system. The PX domain of this protein can bind phospholipid products of the PI(3) kinase, which suggests its role in PI(3) kinase-mediated signaling events. The phosphorylation of this protein was found to negatively regulate the enzyme activity. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]

Uniprot Description

p40phox: a component of the NADPH-oxidase, a multicomponent enzyme system responsible for the oxidative burst. Upon neutrophil stimulation, this protein and other cytosolic elements are sent to the cell membrane from the cytosol to form a complex which produces phagocytic oxygen radicals. Responsible for the downregulation of NADPH-oxidase. Alternative splicing has been observed.

Protein type: Oxidoreductase

Chromosomal Location of Human Ortholog: 22q13.1

Cellular Component: cytosol; endosome membrane; membrane; NADPH oxidase complex

Molecular Function: phosphatidylinositol 3-phosphate binding; protein binding; protein dimerization activity; superoxide-generating NADPH oxidase activator activity

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; cell redox homeostasis; immune response; vascular endothelial growth factor receptor signaling pathway

Disease: Granulomatous Disease, Chronic, Autosomal Recessive, Cytochrome B-positive, Type Iii

Research Articles on NCF4

Similar Products

Product Notes

The NCF4 ncf4 (Catalog #AAA1272360) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgtgg cccagcagct gcgggccgag agtgactttg aacagcttcc ggatgatgtt gccatctcgg ccaacattgc tgacatcgag gagaagagag gcttcaccag ccactttgtt ttcgtcatcg aggtgaagac aaaaggagga tccaagtacc tcatctaccg ccgctaccgc cagttccatg ctttgcagag caagctggag gagcgcttcg ggccagacag caagagcagt gccctggcct gtaccctgcc cacactccca gccaaagtct acgtgggtgt gaaacaggag atcgccgaga tgcggatacc tgccctcaac gcctacatga agagcctgct cagcctgccg gtctgggtgc tgatggatga ggacgtccgg atcttctttt accagtcgcc ctatgactca gagcaggtgc cccaggcact ccgccggctc cgcccgcgca cccggaaagt caagagcgtg tccccacagg gcaacagcgt tgaccgcatg gcagctccga gagcagaggc tctatttgac ttcactggaa acagcaaact ggagctgaat ttcaaagctg gagatgtgat cttcctcctc agtcggatca acaaagactg gctggagggc actgtccggg gagccacggg catcttccct ctctccttcg tgaagatcct caaagacttc cctgaggagg acgaccccac caactggctg cgttgctact actacgaaga caccatcagc accatcaagt ctgtggcctg ggagggaggg gcctgtccag ccttcctgcc atccctacga ccaccgcccc tcacatcacc ttctcatggg tccctctccc actccaaagc ccccagtggc tcccagatga gccacaatgc tgtaacaagc catcaacgtc cagggtggcc tggccagcct cattcccctt tcccccaccc cacaccccac ttccagcctg atgcctcctt actccagcct gtcaccccct tagggacatc gcggtggagg aagatctcag cagcactccc ctattga. It is sometimes possible for the material contained within the vial of "NCF4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.