Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NAT9 cdna clone

NAT9 cDNA Clone

Gene Names
NAT9; EBSP, hNATL
Synonyms
NAT9; NAT9 cDNA Clone; NAT9 cdna clone
Ordering
For Research Use Only!
Sequence
atgaggttgaatcagaacaccttgctgctggggaagaaggtggtccttgtaccctacacctcggagcatgtgcccaggtaccacgagtggatgaaatcagaggagctgcagcgtttgacagcctcggagccgctgaccctggagcaggagtatgccatgcagtgcagctggcaggaagatgcagacaagtgtaccttcattgtgctggatgccgagaagtggcaggcccagccaggcgccaccgaagagagctgcatggtgggagatgtgaacctcttcctcacagatctagaagacctcaccttgggggagatcgaggtcatgattgcagagcccagctgcaggggtaagggccttggcactgaggccgttctcgcgatgctgtcttacggagtgaccacgctaggtctgaccaagtttgaggctaaaattgggcaaggaaatgaaccaagcatccggatgttccagaaacttcactttgagcaggtggctacgagcagtgtttttcaggaggtgaccctcagactgacagtgagtgagtccgagcatcagtggcttctggagcagaccagccacgtggaagagaagccttacagagatgggtcggcagagccctgctga
Sequence Length
621
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,274 Da
NCBI Official Full Name
Homo sapiens N-acetyltransferase 9 (GCN5-related, putative), mRNA
NCBI Official Synonym Full Names
N-acetyltransferase 9 (putative)
NCBI Official Symbol
NAT9
NCBI Official Synonym Symbols
EBSP, hNATL
NCBI Protein Information
N-acetyltransferase 9
UniProt Protein Name
N-acetyltransferase 9
Protein Family
UniProt Gene Name
NAT9
UniProt Synonym Gene Names
EBS
UniProt Entry Name
NAT9_HUMAN

Uniprot Description

NAT9: Belongs to the acetyltransferase family. GNAT subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 2.3.1.-; Acetyltransferase

Chromosomal Location of Human Ortholog: 17q25.1

Cellular Component: protein complex

Molecular Function: N-acetyltransferase activity; protein binding

Biological Process: N-terminal protein amino acid acetylation

Research Articles on NAT9

Similar Products

Product Notes

The NAT9 nat9 (Catalog #AAA1269275) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggttga atcagaacac cttgctgctg gggaagaagg tggtccttgt accctacacc tcggagcatg tgcccaggta ccacgagtgg atgaaatcag aggagctgca gcgtttgaca gcctcggagc cgctgaccct ggagcaggag tatgccatgc agtgcagctg gcaggaagat gcagacaagt gtaccttcat tgtgctggat gccgagaagt ggcaggccca gccaggcgcc accgaagaga gctgcatggt gggagatgtg aacctcttcc tcacagatct agaagacctc accttggggg agatcgaggt catgattgca gagcccagct gcaggggtaa gggccttggc actgaggccg ttctcgcgat gctgtcttac ggagtgacca cgctaggtct gaccaagttt gaggctaaaa ttgggcaagg aaatgaacca agcatccgga tgttccagaa acttcacttt gagcaggtgg ctacgagcag tgtttttcag gaggtgaccc tcagactgac agtgagtgag tccgagcatc agtggcttct ggagcagacc agccacgtgg aagagaagcc ttacagagat gggtcggcag agccctgctg a. It is sometimes possible for the material contained within the vial of "NAT9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.