NARS2 cdna clone
NARS2 cDNA Clone
Gene Names
NARS2; SLM5; asnRS; DFNB94
Synonyms
NARS2; NARS2 cDNA Clone; NARS2 cdna clone
Sequence
atgctgggggtccgctgcctgctgcggtccgtgcgcttctgttcctccgcccccttccccaagcacaaaccttcagccaaactgagcgtgcgggacgctctcggggctcagaacgcgagtggggagcgcattaagatccagggatggattcgttctgtccgatcccagaaggaagtcttgttcctgcatgtaaatgatgggtcatctttggaaagccttcaggttgttgcagattcaggccttgacagtagagaattaacttttgggagttctgtggaagtacaagggcagctgataaaaagtccatccaaaaggcaaaatgtggaactgaaggcagaaaaaattaaagttattggaaattgtgatgccaaggatttccccatcaaatataaagagaggcatcctctggagtacctgcgacaatatcctcactttaggtgtaggactaacgttctgggttctatattgaggattcgcagtgaagcgacagctgctattcattctttctttaaggacagtggctttgtacatattcatactccaataatcacatccaatgactctgagggagctggagaactttttcaacttgaaccttcaggcaaacttaaggtacctgaggagaatttcttcaatgttcctgctttcttaactgtctcaggacaacttcatctagaagtgatgtcaggagcttttactcaagtgtttacctttggtccgaccttccgagctgaaaattctcagagccggaggcacctggcagagttttatatgatagaagcagagatttcttttgttgacagccttcaagatcttatgcaggttatagaggaactgttcaaggctacaacaatgatggttctctcaaaatgtcctgaagatgttgaactctgtcacaaattcatagcacctggccaaaaggacagattagaacatatgctaaaaaacaactttttaatcatttcttatactgaagcagtggagatcttaaagcaagcatcccagaacttcacctttaccccagagtggggtgctgacctacggactgaacatgaaaagtacctggtgaagcactgtggcaacatacctgtcttcgttattaattatccattaacactcaagcctttctacatgagggataatgaagatggccctcagcacacggttgctgctgttgatcttctggttcctggagttggggaactctttggaggaggcctcagagaagaacgataccatttcttagaggagcgcttagccagatcgggacttacagaagtctaccaatggtatctggaccttcgtcgatttggatctgtgccacatggaggttttgggatgggatttgaacgctacctgcagtgcatcttgggtgttgacaatatcaaagatgttatccctttcccaaggtttcctcattcatgccttttatag
Sequence Length
1434
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
28,783 Da
NCBI Official Full Name
Homo sapiens asparaginyl-tRNA synthetase 2, mitochondrial (putative), mRNA
NCBI Official Synonym Full Names
asparaginyl-tRNA synthetase 2, mitochondrial (putative)
NCBI Official Symbol
NARS2
NCBI Official Synonym Symbols
SLM5; asnRS; DFNB94
NCBI Protein Information
probable asparagine--tRNA ligase, mitochondrial
UniProt Protein Name
Probable asparagine--tRNA ligase, mitochondrial
UniProt Gene Name
NARS2
UniProt Synonym Gene Names
AsnRS
UniProt Entry Name
SYNM_HUMAN
NCBI Description
This gene encodes a putative member of the class II family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of asparagine to tRNA molecules. Mutations in this gene have been associated with combined oxidative phosphorylation deficiency 24 (COXPD24). [provided by RefSeq, Mar 2015]
Uniprot Description
NARS2: Belongs to the class-II aminoacyl-tRNA synthetase family.
Protein type: Mitochondrial; Translation; Ligase; EC 6.1.1.22
Chromosomal Location of Human Ortholog: 11q14.1
Cellular Component: mitochondrion
Molecular Function: asparagine-tRNA ligase activity
Biological Process: asparaginyl-tRNA aminoacylation
Disease: Combined Oxidative Phosphorylation Deficiency 24
Research Articles on NARS2
Similar Products
Product Notes
The NARS2 nars2 (Catalog #AAA1268114) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggggg tccgctgcct gctgcggtcc gtgcgcttct gttcctccgc ccccttcccc aagcacaaac cttcagccaa actgagcgtg cgggacgctc tcggggctca gaacgcgagt ggggagcgca ttaagatcca gggatggatt cgttctgtcc gatcccagaa ggaagtcttg ttcctgcatg taaatgatgg gtcatctttg gaaagccttc aggttgttgc agattcaggc cttgacagta gagaattaac ttttgggagt tctgtggaag tacaagggca gctgataaaa agtccatcca aaaggcaaaa tgtggaactg aaggcagaaa aaattaaagt tattggaaat tgtgatgcca aggatttccc catcaaatat aaagagaggc atcctctgga gtacctgcga caatatcctc actttaggtg taggactaac gttctgggtt ctatattgag gattcgcagt gaagcgacag ctgctattca ttctttcttt aaggacagtg gctttgtaca tattcatact ccaataatca catccaatga ctctgaggga gctggagaac tttttcaact tgaaccttca ggcaaactta aggtacctga ggagaatttc ttcaatgttc ctgctttctt aactgtctca ggacaacttc atctagaagt gatgtcagga gcttttactc aagtgtttac ctttggtccg accttccgag ctgaaaattc tcagagccgg aggcacctgg cagagtttta tatgatagaa gcagagattt cttttgttga cagccttcaa gatcttatgc aggttataga ggaactgttc aaggctacaa caatgatggt tctctcaaaa tgtcctgaag atgttgaact ctgtcacaaa ttcatagcac ctggccaaaa ggacagatta gaacatatgc taaaaaacaa ctttttaatc atttcttata ctgaagcagt ggagatctta aagcaagcat cccagaactt cacctttacc ccagagtggg gtgctgacct acggactgaa catgaaaagt acctggtgaa gcactgtggc aacatacctg tcttcgttat taattatcca ttaacactca agcctttcta catgagggat aatgaagatg gccctcagca cacggttgct gctgttgatc ttctggttcc tggagttggg gaactctttg gaggaggcct cagagaagaa cgataccatt tcttagagga gcgcttagcc agatcgggac ttacagaagt ctaccaatgg tatctggacc ttcgtcgatt tggatctgtg ccacatggag gttttgggat gggatttgaa cgctacctgc agtgcatctt gggtgttgac aatatcaaag atgttatccc tttcccaagg tttcctcatt catgcctttt atag. It is sometimes possible for the material contained within the vial of "NARS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
