Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NARFL cdna clone

NARFL cDNA Clone

Gene Names
NARFL; PRN; HPRN; IOP1; NAR1; LET1L
Synonyms
NARFL; NARFL cDNA Clone; NARFL cdna clone
Ordering
For Research Use Only!
Sequence
atggcgtcgcccttcagcggggcgctgcagctgacggacctggatgacttcatcgggccgtctcaggagtgcatcaagcctgtcaaagtggaaaaaagggcgggaagtggcgtggccaagattcgcattgaagatgacgggagctacttccaaattaaccaagacggcgggacccggaggctggagaaggccaaggtctcgctaaacgactgcctggcgtgcagcggctgcatcacctccgcagagaccgtgcttatcacccagcagagccacgaggagctgaagaaggttctagatgctaacaagatggcggcacccagtcagcagaggctggttgtagtttcggtctcaccacagtctagagcatcgctggctgcacggtttcagctgaatcctacagatactgccaggaaattaacctcattctttaaaaaaataggggtgcacttcgtcttcgacaccgccttctcaaggcacttcagcctcctggagagccagcgagagtttgtgcggcgattccgaggacaggccgactgcagacaggcgctgcccctgctggcctctgcctgcccaggctggatctgctatgccgagaagactcacggcagcttcatcctcccccacatcagcaccgcccggtccccgcagcaggtcatgggctccctggtcaaggacttcttcgcccagcagcagcacttgacccctgacaagatctaccacgtcacagtgatgccctgctatgacaaaaagctggaagcctccagacccgactttttcaaccaggagcaccagacacgggatgtggactgtgtcctcacaacaggagaagttttcaggttgctggaggaagagggcgtctccctccccgacctggaaccagcccctctggacagcctgtgcagcggtgcctctgcagaggagcccaccagccatcggggagggggctcggggggctacctggagcacgtgttccggcacgcggcccgagagctctttggaatccatgtggctgaggttacctacaaacccctgaggaacaaagacttccaggaggtgacactggagaaggagggccaggtgctgctgcacttcgcaatggcgtacggcttccgcaacatccagaacctggtgcagaggctcaaacgagggcgctgcccctaccactacgtggaggtcatggcctgcccctcaggctgcctgaacggcgggggccagctccaggccccagacaggcccagcagagagctcctccagcacgtggagagactgtacggcatggtccgggctgaggcgcccgaggacgcgcctggggttcaggagctgtacacacactggctgcagggcacggactcggagtgtgcaggtcgcttgctgcatacgcagtaccacgccgtggagaaggccagcactggcctgggcatccggtggtag
Sequence Length
1431
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,010 Da
NCBI Official Full Name
Homo sapiens nuclear prelamin A recognition factor-like, mRNA
NCBI Official Synonym Full Names
nuclear prelamin A recognition factor like
NCBI Official Symbol
NARFL
NCBI Official Synonym Symbols
PRN; HPRN; IOP1; NAR1; LET1L
NCBI Protein Information
cytosolic Fe-S cluster assembly factor NARFL
UniProt Protein Name
Cytosolic Fe-S cluster assembly factor NARFL
UniProt Gene Name
NARFL
UniProt Synonym Gene Names
PRN; IOP1
UniProt Entry Name
NARFL_HUMAN

Uniprot Description

NARFL: Component of the cytosolic iron-sulfur (Fe/S) protein assembly machinery. Required for maturation of extramitochondrial Fe/S proteins. Seems to negatively regulate the level of HIF1A expression, although this effect could be indirect. Belongs to the NARF family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 16p13.3

Biological Process: iron-sulfur cluster assembly; oxygen homeostasis; regulation of gene expression; response to hypoxia

Research Articles on NARFL

Similar Products

Product Notes

The NARFL narfl (Catalog #AAA1265628) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtcgc ccttcagcgg ggcgctgcag ctgacggacc tggatgactt catcgggccg tctcaggagt gcatcaagcc tgtcaaagtg gaaaaaaggg cgggaagtgg cgtggccaag attcgcattg aagatgacgg gagctacttc caaattaacc aagacggcgg gacccggagg ctggagaagg ccaaggtctc gctaaacgac tgcctggcgt gcagcggctg catcacctcc gcagagaccg tgcttatcac ccagcagagc cacgaggagc tgaagaaggt tctagatgct aacaagatgg cggcacccag tcagcagagg ctggttgtag tttcggtctc accacagtct agagcatcgc tggctgcacg gtttcagctg aatcctacag atactgccag gaaattaacc tcattcttta aaaaaatagg ggtgcacttc gtcttcgaca ccgccttctc aaggcacttc agcctcctgg agagccagcg agagtttgtg cggcgattcc gaggacaggc cgactgcaga caggcgctgc ccctgctggc ctctgcctgc ccaggctgga tctgctatgc cgagaagact cacggcagct tcatcctccc ccacatcagc accgcccggt ccccgcagca ggtcatgggc tccctggtca aggacttctt cgcccagcag cagcacttga cccctgacaa gatctaccac gtcacagtga tgccctgcta tgacaaaaag ctggaagcct ccagacccga ctttttcaac caggagcacc agacacggga tgtggactgt gtcctcacaa caggagaagt tttcaggttg ctggaggaag agggcgtctc cctccccgac ctggaaccag cccctctgga cagcctgtgc agcggtgcct ctgcagagga gcccaccagc catcggggag ggggctcggg gggctacctg gagcacgtgt tccggcacgc ggcccgagag ctctttggaa tccatgtggc tgaggttacc tacaaacccc tgaggaacaa agacttccag gaggtgacac tggagaagga gggccaggtg ctgctgcact tcgcaatggc gtacggcttc cgcaacatcc agaacctggt gcagaggctc aaacgagggc gctgccccta ccactacgtg gaggtcatgg cctgcccctc aggctgcctg aacggcgggg gccagctcca ggccccagac aggcccagca gagagctcct ccagcacgtg gagagactgt acggcatggt ccgggctgag gcgcccgagg acgcgcctgg ggttcaggag ctgtacacac actggctgca gggcacggac tcggagtgtg caggtcgctt gctgcatacg cagtaccacg ccgtggagaa ggccagcact ggcctgggca tccggtggta g. It is sometimes possible for the material contained within the vial of "NARFL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.