Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NARF cdna clone

NARF cDNA Clone

Gene Names
NARF; IOP2
Synonyms
NARF; NARF cDNA Clone; NARF cdna clone
Ordering
For Research Use Only!
Sequence
atgaagtgtgagcactgcacgcgcaaggaatgtagtaagaaaacaaaaactgatgaccaagagaatgtgtcagccgatgcaccgagtccagcccaggaaaatggagagaaatgtgatacctcaaagcacaaagtgctggtagtgtctgtgtgtcctcaatctttgccttattttgctgctaaattcaacctcagtgtaactgatgcatccagaagactctgtggtttcctcaaaagtcttggggtgcactatgtatttgatacgacgatagctgcggattttagtatcctggagagtcaaaaagaattcgtgcgtcgctatcgccagcacagtgaggaggaacgcaccctgcccatgctgacctctgcctgtcctggctgggtccgatacgccgagcgggtgctgggtcgccccatcactgcccacctctgcaccgccaagtccccccagcaggtcatgggctctttggtgaaggattatttcgccagacagcagaacctgtctccagagaagattttccacgtcattgtggccccttgttatgacaagaagctggaggctcttcaggaaagccttccccctgctttgcatggctcccggggcgctgactgcgtgttaacatcaggtgaaattgctcaaataatggagcaaggtgacctctcagtgagagatgctgccgtcgacactctgtttggagacttgaaggaggacaaagtgacgcgtcatgatggagccagctcagacgggcacctggcacacatcttcagacatgcggccaaggagctgttcaacgaggatgtggaggaggtcacttaccgagccctgagaaacaaagacttccaagaggtcacccttgagaagaacggagaggtggtgttacgctttgctgcagcctatggctttcgaaacatccagaacatgatcctgaagcttaagaagggcaagttcccattccactttgtggaggtcctcgcctgtgctggaggatgcttaaatggcagaggccaagcccagactccagacggacatgcggataaggccctgctgcggcagatggaaggcatttacgctgacatccctgtgcggcgtccggagtccagtgcacacgtgcaggagctgtaccaggagtggctggaggggatcaactcccccaaggcccgagaggtgctgcataccacgtaccagagccaggagcgtggcacacacagcctggacatcaagtggtga
Sequence Length
1227
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,681 Da
NCBI Official Full Name
Homo sapiens nuclear prelamin A recognition factor, mRNA
NCBI Official Synonym Full Names
nuclear prelamin A recognition factor
NCBI Official Symbol
NARF
NCBI Official Synonym Symbols
IOP2
NCBI Protein Information
nuclear prelamin A recognition factor
UniProt Protein Name
Nuclear prelamin A recognition factor
UniProt Gene Name
NARF
UniProt Synonym Gene Names
IOP2
UniProt Entry Name
NARF_HUMAN

NCBI Description

Several proteins have been found to be prenylated and methylated at their carboxyl-terminal ends. Prenylation was initially believed to be important only for membrane attachment. However, another role for prenylation appears to be its importance in protein-protein interactions. The only nuclear proteins known to be prenylated in mammalian cells are prelamin A- and B-type lamins. Prelamin A is farnesylated and carboxymethylated on the cysteine residue of a carboxyl-terminal CaaX motif. This post-translationally modified cysteine residue is removed from prelamin A when it is endoproteolytically processed into mature lamin A. The protein encoded by this gene binds to the prenylated prelamin A carboxyl-terminal tail domain. It may be a component of a prelamin A endoprotease complex. The encoded protein is located in the nucleus, where it partially colocalizes with the nuclear lamina. It shares limited sequence similarity with iron-only bacterial hydrogenases. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene, including one with a novel exon that is generated by RNA editing. [provided by RefSeq, Jul 2008]

Uniprot Description

NARF: Several proteins have been found to be prenylated and methylated at their carboxyl-terminal ends. Prenylation was initially believed to be important only for membrane attachment. However, another role for prenylation appears to be its importance in protein-protein interactions. The only nuclear proteins known to be prenylated in mammalian cells are prelamin A- and B-type lamins. Prelamin A is farnesylated and carboxymethylated on the cysteine residue of a carboxyl-terminal CaaX motif. This post-translationally modified cysteine residue is removed from prelamin A when it is endoproteolytically processed into mature lamin A. The protein encoded by this gene binds to the prenylated prelamin A carboxyl-terminal tail domain. It may be a component of a prelamin A endoprotease complex. The encoded protein is located in the nucleus, where it partially colocalizes with the nuclear lamina. It shares limited sequence similarity with iron-only bacterial hydrogenases. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene, including one with a novel exon that is generated by RNA editing. [provided by RefSeq, Jul 2008]

Chromosomal Location of Human Ortholog: 17q25.3

Cellular Component: lamin filament; nuclear lamina; nuclear lumen

Molecular Function: lamin binding

Research Articles on NARF

Similar Products

Product Notes

The NARF narf (Catalog #AAA1277200) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagtgtg agcactgcac gcgcaaggaa tgtagtaaga aaacaaaaac tgatgaccaa gagaatgtgt cagccgatgc accgagtcca gcccaggaaa atggagagaa atgtgatacc tcaaagcaca aagtgctggt agtgtctgtg tgtcctcaat ctttgcctta ttttgctgct aaattcaacc tcagtgtaac tgatgcatcc agaagactct gtggtttcct caaaagtctt ggggtgcact atgtatttga tacgacgata gctgcggatt ttagtatcct ggagagtcaa aaagaattcg tgcgtcgcta tcgccagcac agtgaggagg aacgcaccct gcccatgctg acctctgcct gtcctggctg ggtccgatac gccgagcggg tgctgggtcg ccccatcact gcccacctct gcaccgccaa gtccccccag caggtcatgg gctctttggt gaaggattat ttcgccagac agcagaacct gtctccagag aagattttcc acgtcattgt ggccccttgt tatgacaaga agctggaggc tcttcaggaa agccttcccc ctgctttgca tggctcccgg ggcgctgact gcgtgttaac atcaggtgaa attgctcaaa taatggagca aggtgacctc tcagtgagag atgctgccgt cgacactctg tttggagact tgaaggagga caaagtgacg cgtcatgatg gagccagctc agacgggcac ctggcacaca tcttcagaca tgcggccaag gagctgttca acgaggatgt ggaggaggtc acttaccgag ccctgagaaa caaagacttc caagaggtca cccttgagaa gaacggagag gtggtgttac gctttgctgc agcctatggc tttcgaaaca tccagaacat gatcctgaag cttaagaagg gcaagttccc attccacttt gtggaggtcc tcgcctgtgc tggaggatgc ttaaatggca gaggccaagc ccagactcca gacggacatg cggataaggc cctgctgcgg cagatggaag gcatttacgc tgacatccct gtgcggcgtc cggagtccag tgcacacgtg caggagctgt accaggagtg gctggagggg atcaactccc ccaaggcccg agaggtgctg cataccacgt accagagcca ggagcgtggc acacacagcc tggacatcaa gtggtga. It is sometimes possible for the material contained within the vial of "NARF, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.