Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NAPRT1 cdna clone

NAPRT1 cDNA Clone

Gene Names
NAPRT; NAPRT1; PP3856
Synonyms
NAPRT1; NAPRT1 cDNA Clone; NAPRT1 cdna clone
Ordering
For Research Use Only!
Sequence
atgttggcgccagcagctggtgagggccctggggtggacctggcggccaaagcccaggtgtggctggagcaggtgtgtgcccacctggggctgggggtgcaggagccacatccaggcgagcgggcagcctttgtggcctatgccttggcttttccccgggccttccagggcctcctggacacctacagcgtgtggaggagtggtctccccaacttcctagcagtcgccttggccctgggagagctgggctaccgggcagtgggcgtgaggctggacagtggtgacctgctacagcaggctcaggagatccgcaaggtcttccgagctgctgcagcccagttccaggtgccctggctggagtcagtcctcatcgtagtcagcaacaacattgacgaggaggcgctggcccgactggcccaggagggcagtgaggtgaatgtcattggcattggcaccagtgtggtcacctgcccccaacagccttccctgggtggcgtctataagctggtggccgtggggggccagccacgaatgaagctgaccgaggaccccgagaagcagacgttgcctgggagcaaggctgctttccggctcctgggctctgacgggtctccactcatggacatgctgcagttagcagaagagccagtgccacaggctgggcaggagctgagggtgtggcctccaggggcccaggagccctgcaccgtgaggccagcccaggtggagccactactgcggctctgcctccagcagggacagctgtgtgagccgctcccatccctggcagagtctagagccttggcccagctgtccctgagccgactcagccctgagcacaggcggctgcggagccctgcacagtaccaggtggtgctgtccgagaggctgcaggccctggtgaacagtctgtgtgcggggcagtccccctga
Sequence Length
933
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,099 Da
NCBI Official Full Name
Homo sapiens nicotinate phosphoribosyltransferase domain containing 1, mRNA
NCBI Official Synonym Full Names
nicotinate phosphoribosyltransferase
NCBI Official Symbol
NAPRT
NCBI Official Synonym Symbols
NAPRT1; PP3856
NCBI Protein Information
nicotinate phosphoribosyltransferase
UniProt Protein Name
Nicotinate phosphoribosyltransferase
UniProt Gene Name
NAPRT
UniProt Synonym Gene Names
FHIP; NAPRT1; NAPRTase
UniProt Entry Name
PNCB_HUMAN

NCBI Description

Nicotinic acid (NA; niacin) is converted by nicotinic acid phosphoribosyltransferase (NAPRT; EC 2.4.2.11) to NA mononucleotide (NaMN), which is then converted to NA adenine dinucleotide (NaAD), and finally to nicotinamide adenine dinucleotide (NAD), which serves as a coenzyme in cellular redox reactions and is an essential component of a variety of processes in cellular metabolism including response to stress (Hara et al., 2007).[supplied by OMIM, Mar 2008]

Uniprot Description

NAPRT1: Catalyzes the conversion of nicotinic acid (NA) to NA mononucleotide (NaMN). Essential for NA to increase cellular NAD levels and prevent oxidative stress of the cells. Belongs to the NAPRTase family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.4.21; Transferase

Chromosomal Location of Human Ortholog: 8q24.3

Cellular Component: cytoplasm; cytosol; Golgi apparatus; nucleus

Molecular Function: nicotinate phosphoribosyltransferase activity; protein binding

Biological Process: nicotinamide metabolic process; response to oxidative stress

Research Articles on NAPRT1

Similar Products

Product Notes

The NAPRT1 naprt (Catalog #AAA1269860) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttggcgc cagcagctgg tgagggccct ggggtggacc tggcggccaa agcccaggtg tggctggagc aggtgtgtgc ccacctgggg ctgggggtgc aggagccaca tccaggcgag cgggcagcct ttgtggccta tgccttggct tttccccggg ccttccaggg cctcctggac acctacagcg tgtggaggag tggtctcccc aacttcctag cagtcgcctt ggccctggga gagctgggct accgggcagt gggcgtgagg ctggacagtg gtgacctgct acagcaggct caggagatcc gcaaggtctt ccgagctgct gcagcccagt tccaggtgcc ctggctggag tcagtcctca tcgtagtcag caacaacatt gacgaggagg cgctggcccg actggcccag gagggcagtg aggtgaatgt cattggcatt ggcaccagtg tggtcacctg cccccaacag ccttccctgg gtggcgtcta taagctggtg gccgtggggg gccagccacg aatgaagctg accgaggacc ccgagaagca gacgttgcct gggagcaagg ctgctttccg gctcctgggc tctgacgggt ctccactcat ggacatgctg cagttagcag aagagccagt gccacaggct gggcaggagc tgagggtgtg gcctccaggg gcccaggagc cctgcaccgt gaggccagcc caggtggagc cactactgcg gctctgcctc cagcagggac agctgtgtga gccgctccca tccctggcag agtctagagc cttggcccag ctgtccctga gccgactcag ccctgagcac aggcggctgc ggagccctgc acagtaccag gtggtgctgt ccgagaggct gcaggccctg gtgaacagtc tgtgtgcggg gcagtccccc tga. It is sometimes possible for the material contained within the vial of "NAPRT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.