NAPRT1 cdna clone

NAPRT1 cDNA Clone

Gene Names

NAPRT; NAPRT1; PP3856

Synonyms

NAPRT1; NAPRT1 cDNA Clone; NAPRT1 cdna clone

Ordering
Cat. Num. AAA1265788 For Research Use Only!

Sequence

atggcgttgggctattggcgcgcgggccgggcgcgggacgccgccgagttcgagctcttcttccgccgctgcccgttcggcggcgccttcgccttggccgccggcttgcgcgactgtgtgcgcttcctgcgcgccttccgcctgcgggacgccgacgtgcagttcctggcctcggtgctgcccccagacacggatcctgcgttcttcgagcaccttcgggccctcgactgctccgaggtgacggtgcgagccctgcccgagggctccctcgccttccccggagtgccgctcctgcaggtgtccgggccgctcctggtggtgcagctgctggagacaccgctgctctgcctggtcagctacgccagcctggtggccaccaacgcagcgcggcttcgcttgatcgcagggccagagaagcggctgctagagatgggcctgaggcgggctcagggccccgatgggggcctgacagcctccacctacagctacctgggcggcttcgacagcagcagcaacgtgctagcgggccagctgcgaggtgtgccggtggccgggaccctggcccactccttcgtcacttccttttcaggcagcgaggtgccccctgacccgatgttggcgccagcagctggtgagggccctggggtggacctggcggccaaagcccaggtgtggctggagcaggtgtgtgcccacctggggctgggggtgcaggagccgcatccaggcgagcgggcagcctttgtggcctatgccttggcttttccccgggccttccagggcctcctggacacctacagcgtgtggaggagtggtctccccaacttcctagcagtcgccttggccctgggagagctgggctaccgggcagtgggcgtgaggctggacagtggtgacctgctacagcaggctcaggagatccgcaaggtcttccgagctgctgcagcccagttccaggtgccctggctggagtcagtcctcatcgtagtcagcaacaacattgacgaggaggcgctggcccgactggcccaggagggcagtgaggtgaatgtcattggcattggcaccagtgtggtcacctgcccccaacagccttccctgggtggcgtctataagctggtggccgtggggggccagccacgaatgaagctgaccgaggaccccgagaagcagacgttgcctgggagcaaggctgctttccggctcctgggctctgacgggtctccactcatggacatgctgcagttagcagaagagccagtgccacaggctgggcaggagctgagggtgtggcctccaggggcccaggagccctgcaccgtgaggccagcccaggtggagccactactgcggctctgcctccagcagggacagctgtgtgagccgctcccatccctggcagagtctagagccttggcccagctgtccctgagccgactcagccctgagcacaggcggctgcggagccctgcacagtaccaggtggtgctgtccgagaggctgcaggccctggtgaacagtctgtgtgcggggcagtccccctga

Sequence Length

1545

Vector

Please Inquire

NCBI and Uniprot Product Information

NCBI GI #

33991171

NCBI GeneID

93100

Molecular Weight

56,099 Da

NCBI Official Full Name

Homo sapiens nicotinate phosphoribosyltransferase domain containing 1, mRNA

NCBI Official Synonym Full Names

nicotinate phosphoribosyltransferase

NCBI Official Symbol

NAPRT

NCBI Official Synonym Symbols

NAPRT1; PP3856

NCBI Protein Information

nicotinate phosphoribosyltransferase

UniProt Protein Name

Nicotinate phosphoribosyltransferase

UniProt Gene Name

NAPRT

UniProt Synonym Gene Names

FHIP; NAPRT1; NAPRTase

UniProt Entry Name

PNCB_HUMAN

NCBI Description

Nicotinic acid (NA; niacin) is converted by nicotinic acid phosphoribosyltransferase (NAPRT; EC 2.4.2.11) to NA mononucleotide (NaMN), which is then converted to NA adenine dinucleotide (NaAD), and finally to nicotinamide adenine dinucleotide (NAD), which serves as a coenzyme in cellular redox reactions and is an essential component of a variety of processes in cellular metabolism including response to stress (Hara et al., 2007).[supplied by OMIM, Mar 2008]

Uniprot Description

NAPRT1: Catalyzes the conversion of nicotinic acid (NA) to NA mononucleotide (NaMN). Essential for NA to increase cellular NAD levels and prevent oxidative stress of the cells. Belongs to the NAPRTase family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.4.21; Transferase

Chromosomal Location of Human Ortholog: 8q24.3

Cellular Component: cytoplasm; cytosol; Golgi apparatus; nucleus

Molecular Function: nicotinate phosphoribosyltransferase activity; protein binding

Biological Process: nicotinamide metabolic process; response to oxidative stress

Research Articles on NAPRT1

1. Tumor-specific promoter hypermethylation of NAPRT1 inactivates one of two NAD salvage pathways, resulting in synthetic lethality with the coadministration of a NAMPT inhibitor.

Similar Products

Product Notes

The NAPRT1 naprt (Catalog #AAA1265788) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgttgg gctattggcg cgcgggccgg gcgcgggacg ccgccgagtt cgagctcttc ttccgccgct gcccgttcgg cggcgccttc gccttggccg ccggcttgcg cgactgtgtg cgcttcctgc gcgccttccg cctgcgggac gccgacgtgc agttcctggc ctcggtgctg cccccagaca cggatcctgc gttcttcgag caccttcggg ccctcgactg ctccgaggtg acggtgcgag ccctgcccga gggctccctc gccttccccg gagtgccgct cctgcaggtg tccgggccgc tcctggtggt gcagctgctg gagacaccgc tgctctgcct ggtcagctac gccagcctgg tggccaccaa cgcagcgcgg cttcgcttga tcgcagggcc agagaagcgg ctgctagaga tgggcctgag gcgggctcag ggccccgatg ggggcctgac agcctccacc tacagctacc tgggcggctt cgacagcagc agcaacgtgc tagcgggcca gctgcgaggt gtgccggtgg ccgggaccct ggcccactcc ttcgtcactt ccttttcagg cagcgaggtg ccccctgacc cgatgttggc gccagcagct ggtgagggcc ctggggtgga cctggcggcc aaagcccagg tgtggctgga gcaggtgtgt gcccacctgg ggctgggggt gcaggagccg catccaggcg agcgggcagc ctttgtggcc tatgccttgg cttttccccg ggccttccag ggcctcctgg acacctacag cgtgtggagg agtggtctcc ccaacttcct agcagtcgcc ttggccctgg gagagctggg ctaccgggca gtgggcgtga ggctggacag tggtgacctg ctacagcagg ctcaggagat ccgcaaggtc ttccgagctg ctgcagccca gttccaggtg ccctggctgg agtcagtcct catcgtagtc agcaacaaca ttgacgagga ggcgctggcc cgactggccc aggagggcag tgaggtgaat gtcattggca ttggcaccag tgtggtcacc tgcccccaac agccttccct gggtggcgtc tataagctgg tggccgtggg gggccagcca cgaatgaagc tgaccgagga ccccgagaag cagacgttgc ctgggagcaa ggctgctttc cggctcctgg gctctgacgg gtctccactc atggacatgc tgcagttagc agaagagcca gtgccacagg ctgggcagga gctgagggtg tggcctccag gggcccagga gccctgcacc gtgaggccag cccaggtgga gccactactg cggctctgcc tccagcaggg acagctgtgt gagccgctcc catccctggc agagtctaga gccttggccc agctgtccct gagccgactc agccctgagc acaggcggct gcggagccct gcacagtacc aggtggtgct gtccgagagg ctgcaggccc tggtgaacag tctgtgtgcg gggcagtccc cctga. It is sometimes possible for the material contained within the vial of "NAPRT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

NAPRT1 cdna clone