Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NAPEPLD cdna clone

NAPEPLD cDNA Clone

Gene Names
NAPEPLD; FMP30; NAPE-PLD
Synonyms
NAPEPLD; NAPEPLD cDNA Clone; NAPEPLD cdna clone
Ordering
For Research Use Only!
Sequence
atggatgaaaatgaaagcaaccagtctctgatgacaagcagccaatatcctaaagaagcagtaagaaaacgtcaaaattcagcacggaattccggagcaagtgattcttctaggttttctaggaaaagcttcaaactggattatagactagaagaagatgtaactaaatccaagaaaggaaaagatgggagatttgtgaatccgtggccaacatggaaaaacccctctattccaaatgttctcagatggctgataatggagaaagatcacagcagtgttccaagttctaaagaggaactagacaaagaactcccagtgcttaagccatattttatcactaaccctgaagaagctggagtgagggaagctggcttaagagtcacatggctgggacatgccacggtaatggtggaaatggatgagctcatatttctcacggatcccatctttagctctcgtgcttcaccatcgcagtacatgggtccaaagcgatttcgtcgttccccgtgcacaataagtgaactccctccaatagatgcggtccttatcagtcacaaccactatgaccatctggactacaattctgtcattgctttgaatgagcgatttggtaatgagttgagatggtttgtgcctttgggtctccttgactggatgcaaaaatgtggctgtgagaatgtgattgagttggactggtgggaggagaattgtgtccccggacatgataaggtcacttttgtctttacaccttcccagcactggtgtaaaaggactctaatggatgacaacaaggtgctatggggcagctggtctgtcttggggccttggaatcgattttttttcgcaggagatactggttattgccctgcttttgaagagataggaaaaagatttggaccttttgaccttgcagctattcccatcggagcttatgaaccgaggtggtttatgaaataccagcatgtagacccagaagaagctgtaaggattcacactgatgtccaaacaaagaaatctatggcaattcactggggaacttttgccttagcaaatgagcattacttagagcctccagtgaagctgaatgaagctctagagagatacggacttaacgctgaagatttttttgtcttgaagcatggagaatcaagatacctaaataataatgatgaaaacttttaa
Sequence Length
1182
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,596 Da
NCBI Official Full Name
Homo sapiens N-acyl phosphatidylethanolamine phospholipase D, mRNA
NCBI Official Synonym Full Names
N-acyl phosphatidylethanolamine phospholipase D
NCBI Official Symbol
NAPEPLD
NCBI Official Synonym Symbols
FMP30; NAPE-PLD
NCBI Protein Information
N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D
UniProt Protein Name
N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D
UniProt Gene Name
NAPEPLD
UniProt Synonym Gene Names
C7orf18; N-acyl phosphatidylethanolamine phospholipase D; NAPE-PLD; NAPE-hydrolyzing phospholipase D
UniProt Entry Name
NAPEP_HUMAN

NCBI Description

NAPEPLD is a phospholipase D type enzyme that catalyzes the release of N-acylethanolamine (NAE) from N-acyl-phosphatidylethanolamine (NAPE) in the second step of the biosynthesis of N-acylethanolamine (Okamoto et al., 2004 [PubMed 14634025]).[supplied by OMIM, Oct 2008]

Uniprot Description

NAPEPLD: Hydrolyzes N-acyl-phosphatidylethanolamines (NAPEs) to produce N-acylethanolamines (NAEs) and phosphatidic acid. Responsible for the generation of anandamide (N- arachidonoylethanolamine), the ligand of cannabinoid and vanilloid receptors. Belongs to the NAPE-PLD family.

Protein type: Phospholipase; EC 3.1.4.54

Chromosomal Location of Human Ortholog: 7q22.1

Cellular Component: cytoplasm

Biological Process: retinoid metabolic process

Research Articles on NAPEPLD

Similar Products

Product Notes

The NAPEPLD napepld (Catalog #AAA1265918) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgaaa atgaaagcaa ccagtctctg atgacaagca gccaatatcc taaagaagca gtaagaaaac gtcaaaattc agcacggaat tccggagcaa gtgattcttc taggttttct aggaaaagct tcaaactgga ttatagacta gaagaagatg taactaaatc caagaaagga aaagatggga gatttgtgaa tccgtggcca acatggaaaa acccctctat tccaaatgtt ctcagatggc tgataatgga gaaagatcac agcagtgttc caagttctaa agaggaacta gacaaagaac tcccagtgct taagccatat tttatcacta accctgaaga agctggagtg agggaagctg gcttaagagt cacatggctg ggacatgcca cggtaatggt ggaaatggat gagctcatat ttctcacgga tcccatcttt agctctcgtg cttcaccatc gcagtacatg ggtccaaagc gatttcgtcg ttccccgtgc acaataagtg aactccctcc aatagatgcg gtccttatca gtcacaacca ctatgaccat ctggactaca attctgtcat tgctttgaat gagcgatttg gtaatgagtt gagatggttt gtgcctttgg gtctccttga ctggatgcaa aaatgtggct gtgagaatgt gattgagttg gactggtggg aggagaattg tgtccccgga catgataagg tcacttttgt ctttacacct tcccagcact ggtgtaaaag gactctaatg gatgacaaca aggtgctatg gggcagctgg tctgtcttgg ggccttggaa tcgatttttt ttcgcaggag atactggtta ttgccctgct tttgaagaga taggaaaaag atttggacct tttgaccttg cagctattcc catcggagct tatgaaccga ggtggtttat gaaataccag catgtagacc cagaagaagc tgtaaggatt cacactgatg tccaaacaaa gaaatctatg gcaattcact ggggaacttt tgccttagca aatgagcatt acttagagcc tccagtgaag ctgaatgaag ctctagagag atacggactt aacgctgaag atttttttgt cttgaagcat ggagaatcaa gatacctaaa taataatgat gaaaactttt aa. It is sometimes possible for the material contained within the vial of "NAPEPLD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.