Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

N6AMT1 cdna clone

N6AMT1 cDNA Clone

Gene Names
N6AMT1; MTQ2; HEMK2; N6AMT; PRED28; C21orf127; m.HsaHemK2P
Synonyms
N6AMT1; N6AMT1 cDNA Clone; N6AMT1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcaggggagaacttcgctacgccgttccacgggcacgtgggccgcggcgccttcagcgacgtgtacgagcccgcggaggacacgtttctgcttttggacgcgctcgaggcagcggctgccgaactggcaggagtggaaatatgcctggaagtagggtcagggtctggtgtagtatctgcattcctagcctctatgataggccctcaggctttgtacatgtgcactgatatcaaccctgaggcagcagcttgtaccctagagacagcacgctgtaacaaagttcacattcaaccagttattacagatttggtaggaagtcacggaatagaggcagcttgggctggtggcagaaatggtcgggaagtcatggacaggttttttcccctggttccagatctcctttcaccaagaggattattctatttagttaccattaaagaaaacaacccagaagaaattttgaaaataatgaagacaaaaggtctgcaaggaaccactgcactttccagacaagcaggccaagaaactctttcagtcctcaagttcaccaagtcttag
Sequence Length
561
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,756 Da
NCBI Official Full Name
Homo sapiens N-6 adenine-specific DNA methyltransferase 1 (putative), mRNA
NCBI Official Synonym Full Names
N-6 adenine-specific DNA methyltransferase 1 (putative)
NCBI Official Symbol
N6AMT1
NCBI Official Synonym Symbols
MTQ2; HEMK2; N6AMT; PRED28; C21orf127; m.HsaHemK2P
NCBI Protein Information
hemK methyltransferase family member 2
UniProt Protein Name
HemK methyltransferase family member 2
UniProt Gene Name
N6AMT1
UniProt Synonym Gene Names
C21orf127; HEMK2
UniProt Entry Name
HEMK2_HUMAN

NCBI Description

This gene encodes an N(6)-adenine-specific DNA methyltransferase. The encoded enzyme may be involved in the methylation of release factor I during translation termination. This enzyme is also involved in converting the arsenic metabolite monomethylarsonous acid to the less toxic dimethylarsonic acid. Alternative splicing pf this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 11. [provided by RefSeq, Jul 2014]

Uniprot Description

N6AMT1: Heterodimeric methyltransferase that catalyzes N5- methylation of ETF1 on 'Gln-185', using S-adenosyl L-methionine as methyl donor. ETF1 needs to be complexed to ERF3 in its GTP-bound form to be efficiently methylated. May play a role in the modulation of arsenic-induced toxicity. May be involved in the conversion of monomethylarsonous acid (3+) into the less toxic dimethylarsonic acid. Belongs to the eukaryotic/archaeal PrmC-related family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Methyltransferase; EC 2.1.1.-

Chromosomal Location of Human Ortholog: 21q21.3

Cellular Component: cytosol; protein complex

Molecular Function: protein binding; protein methyltransferase activity

Biological Process: methylation; positive regulation of cell growth; translational termination

Research Articles on N6AMT1

Similar Products

Product Notes

The N6AMT1 n6amt1 (Catalog #AAA1270335) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagggg agaacttcgc tacgccgttc cacgggcacg tgggccgcgg cgccttcagc gacgtgtacg agcccgcgga ggacacgttt ctgcttttgg acgcgctcga ggcagcggct gccgaactgg caggagtgga aatatgcctg gaagtagggt cagggtctgg tgtagtatct gcattcctag cctctatgat aggccctcag gctttgtaca tgtgcactga tatcaaccct gaggcagcag cttgtaccct agagacagca cgctgtaaca aagttcacat tcaaccagtt attacagatt tggtaggaag tcacggaata gaggcagctt gggctggtgg cagaaatggt cgggaagtca tggacaggtt ttttcccctg gttccagatc tcctttcacc aagaggatta ttctatttag ttaccattaa agaaaacaac ccagaagaaa ttttgaaaat aatgaagaca aaaggtctgc aaggaaccac tgcactttcc agacaagcag gccaagaaac tctttcagtc ctcaagttca ccaagtctta g. It is sometimes possible for the material contained within the vial of "N6AMT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.