MYO5C cdna clone
MYO5C cDNA Clone
Synonyms
MYO5C; MYO5C cDNA Clone; MYO5C cdna clone
Sequence
atggcggtggccgagctgtacacgcagtacaacagggtctggattcccgatcctgaagaagtttggaagtctgctgaaatagccaaggactacagagttggtgacaaggtcctgcgactcctgctggaggatggaacggagctggattattctgtcaatccagaatctctgcctccacttcggaatcctgacatcctcgtgggcgagaatgacctcacggctctcagctatcttcacgagcccgcggtgctccacaacctcagaatccgctttgcagaatccaaactcatttacacctacagtggaatcattttggtggccatgaatccttacaagcagttgccaatatacggagatgccatcatccacgcctacagcgggcagaacatgggcgatatggacccacacatatttgccgtggcagaagaggcatacaagcagatggccagaaacaacagaaaccagtccataattgtaagtggggagtcaggtgctggaaagacagtgtcggctcgctatgccatgaggtactttgccaccgtcagcaaatcgggcagcaacgctcacgtggaagacaaggtcctggcatccaatcccatcaccgaggccgttggaaatgccaagaccacccgcaatgacaatagtagtcggtttgggaaatacacagaaatcagttttgatgaacaaaatcaaattataggagccaacatgagcacttacctcctggagaaatccagagttgtctttcaatcggaaaatgaacgaaattaccacattttctatcagctttgtgcatctgcacagcagtcggaatttaaacatcttaaattggggagtgccgaagaatttaattatacaagaatgggaggcaatactgtcattgagggtgtgaatgatcgagctgaaatggtagagactcaaaagaccttcacgcttctgggtttcaaggaggattttcagatggacgtttttaaaatcctggcagccatcctacatctgggcaacgtgcagatcaccgcggtgggcaacgagaggtcctcagttagtgaggatgacagtcacctgaaggtgttctgtgagctcctgggcctggagagtggcagagttgctcagtggctgtgcaatcgcaaaatcgtcacaagctctgagacggtggtaaaacccatgaccaggcctcaggctgtcaacgccagggatgcactggccaaaaagatctatgctcacctgttcgacttcattgtggagagaattaaccaagcgttgcagttttcagttttgaaacctttgatgtga
Sequence Length
1293
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
48,392 Da
NCBI Official Full Name
Homo sapiens myosin VC, mRNA
NCBI Official Synonym Full Names
myosin VC
NCBI Official Symbol
MYO5C
NCBI Protein Information
unconventional myosin-Vc
UniProt Protein Name
Unconventional myosin-Vc
Protein Family
UniProt Gene Name
MYO5C
UniProt Entry Name
MYO5C_HUMAN
Uniprot Description
MYO5C: May be involved in transferrin trafficking. Likely to power actin-based membrane trafficking in many physiologically crucial tissues.
Protein type: Motor; Motility/polarity/chemotaxis
Chromosomal Location of Human Ortholog: 15q21
Research Articles on MYO5C
Similar Products
Product Notes
The MYO5C myo5c (Catalog #AAA1267501) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggtgg ccgagctgta cacgcagtac aacagggtct ggattcccga tcctgaagaa gtttggaagt ctgctgaaat agccaaggac tacagagttg gtgacaaggt cctgcgactc ctgctggagg atggaacgga gctggattat tctgtcaatc cagaatctct gcctccactt cggaatcctg acatcctcgt gggcgagaat gacctcacgg ctctcagcta tcttcacgag cccgcggtgc tccacaacct cagaatccgc tttgcagaat ccaaactcat ttacacctac agtggaatca ttttggtggc catgaatcct tacaagcagt tgccaatata cggagatgcc atcatccacg cctacagcgg gcagaacatg ggcgatatgg acccacacat atttgccgtg gcagaagagg catacaagca gatggccaga aacaacagaa accagtccat aattgtaagt ggggagtcag gtgctggaaa gacagtgtcg gctcgctatg ccatgaggta ctttgccacc gtcagcaaat cgggcagcaa cgctcacgtg gaagacaagg tcctggcatc caatcccatc accgaggccg ttggaaatgc caagaccacc cgcaatgaca atagtagtcg gtttgggaaa tacacagaaa tcagttttga tgaacaaaat caaattatag gagccaacat gagcacttac ctcctggaga aatccagagt tgtctttcaa tcggaaaatg aacgaaatta ccacattttc tatcagcttt gtgcatctgc acagcagtcg gaatttaaac atcttaaatt ggggagtgcc gaagaattta attatacaag aatgggaggc aatactgtca ttgagggtgt gaatgatcga gctgaaatgg tagagactca aaagaccttc acgcttctgg gtttcaagga ggattttcag atggacgttt ttaaaatcct ggcagccatc ctacatctgg gcaacgtgca gatcaccgcg gtgggcaacg agaggtcctc agttagtgag gatgacagtc acctgaaggt gttctgtgag ctcctgggcc tggagagtgg cagagttgct cagtggctgt gcaatcgcaa aatcgtcaca agctctgaga cggtggtaaa acccatgacc aggcctcagg ctgtcaacgc cagggatgca ctggccaaaa agatctatgc tcacctgttc gacttcattg tggagagaat taaccaagcg ttgcagtttt cagttttgaa acctttgatg tga. It is sometimes possible for the material contained within the vial of "MYO5C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
